<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.2 20190208//EN" "http://jats.nlm.nih.gov/publishing/1.2/JATS-journalpublishing1.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" article-type="methods-article" dtd-version="1.2" xml:lang="en">
    <front>
        <journal-meta>
            <journal-id journal-id-type="pmc">Gates Open Res</journal-id>
            <journal-title-group>
                <journal-title>Gates Open Research</journal-title>
            </journal-title-group>
            <issn pub-type="epub">2572-4754</issn>
            <publisher>
                <publisher-name>F1000 Research Limited</publisher-name>
                <publisher-loc>London, UK</publisher-loc>
            </publisher>
        </journal-meta>
        <article-meta>
            <article-id pub-id-type="doi">10.12688/gatesopenres.16355.1</article-id>
            <article-categories>
                <subj-group subj-group-type="heading">
                    <subject>Method Article</subject>
                </subj-group>
                <subj-group>
                    <subject>Articles</subject>
                </subj-group>
            </article-categories>
            <title-group>
                <article-title>An expanded method for malaria parasite genetic surveillance using targeted nanopore sequencing</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Harrott</surname>
                        <given-names>Alexandria J. R.</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Data Curation</role>
                    <role content-type="http://credit.niso.org/">Formal Analysis</role>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Validation</role>
                    <role content-type="http://credit.niso.org/">Visualization</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <xref ref-type="aff" rid="a1">1</xref>
                    <xref ref-type="aff" rid="a2">2</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Morang'a</surname>
                        <given-names>Collins M.</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Data Curation</role>
                    <role content-type="http://credit.niso.org/">Formal Analysis</role>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Project Administration</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <xref ref-type="aff" rid="a3">3</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Pearson</surname>
                        <given-names>Richard D.</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Formal Analysis</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Sakyi</surname>
                        <given-names>Mona-Liza</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <xref ref-type="aff" rid="a3">3</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Osumanu</surname>
                        <given-names>Ahmed</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <xref ref-type="aff" rid="a3">3</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Amoako</surname>
                        <given-names>Enock K.</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <xref ref-type="aff" rid="a3">3</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Bara</surname>
                        <given-names>Fagd&#x00e9;ba David</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <xref ref-type="aff" rid="a3">3</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Hosmillo</surname>
                        <given-names>Myra</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Project Administration</role>
                    <xref ref-type="aff" rid="a4">4</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Rowe</surname>
                        <given-names>Kess</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <role content-type="http://credit.niso.org/">Project Administration</role>
                    <xref ref-type="aff" rid="a4">4</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Aniweh</surname>
                        <given-names>Yaw</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <xref ref-type="aff" rid="a3">3</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Awandare</surname>
                        <given-names>Gordon A.</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Funding Acquisition</role>
                    <xref ref-type="aff" rid="a3">3</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Zeukeng</surname>
                        <given-names>Francis</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Funding Acquisition</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <xref ref-type="aff" rid="a5">5</xref>
                    <xref ref-type="aff" rid="a6">6</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Goodfellow</surname>
                        <given-names>Ian</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Funding Acquisition</role>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <xref ref-type="aff" rid="a4">4</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Ariani</surname>
                        <given-names>Cristina V.</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Funding Acquisition</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="yes">
                    <name>
                        <surname>Amenga-Etego</surname>
                        <given-names>Lucas N.</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Conceptualization</role>
                    <role content-type="http://credit.niso.org/">Data Curation</role>
                    <role content-type="http://credit.niso.org/">Formal Analysis</role>
                    <role content-type="http://credit.niso.org/">Funding Acquisition</role>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Project Administration</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Validation</role>
                    <role content-type="http://credit.niso.org/">Visualization</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <xref ref-type="corresp" rid="c1">a</xref>
                    <xref ref-type="aff" rid="a3">3</xref>
                </contrib>
                <contrib contrib-type="author" corresp="yes">
                    <name>
                        <surname>Hamilton</surname>
                        <given-names>William L.</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Conceptualization</role>
                    <role content-type="http://credit.niso.org/">Data Curation</role>
                    <role content-type="http://credit.niso.org/">Formal Analysis</role>
                    <role content-type="http://credit.niso.org/">Funding Acquisition</role>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Project Administration</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Validation</role>
                    <role content-type="http://credit.niso.org/">Visualization</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Original Draft Preparation</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <uri content-type="orcid">https://orcid.org/0000-0002-3330-353X</uri>
                    <xref ref-type="corresp" rid="c2">b</xref>
                    <xref ref-type="aff" rid="a1">1</xref>
                    <xref ref-type="aff" rid="a7">7</xref>
                    <xref ref-type="aff" rid="a8">8</xref>
                </contrib>
                <aff id="a1">
                    <label>1</label>Wellcome Sanger Institute, Hinxton, England, CB10 1RQ, UK</aff>
                <aff id="a2">
                    <label>2</label>University of Bath Department of Life Sciences, Bath, England, BA2 7AZ, UK</aff>
                <aff id="a3">
                    <label>3</label>West African Centre for Cell Biology of Infectious Pathogens, Legon, Accra, Ghana</aff>
                <aff id="a4">
                    <label>4</label>University of Cambridge Department of Pathology, Cambridge, England, CB2 0QQ, UK</aff>
                <aff id="a5">
                    <label>5</label>University of Yaound&#x00e9; 1, Etetak-Yaounde, P.O. box 17673, Cameroon</aff>
                <aff id="a6">
                    <label>6</label>University of Buea, Buea, P.O. box 63 Buea, Cameroon</aff>
                <aff id="a7">
                    <label>7</label>University of Cambridge Department of Medicine, Cambridge, England, CB2 0QQ, UK</aff>
                <aff id="a8">
                    <label>8</label>Cambridge University Hospitals NHS Foundation Trust, Cambridge, England, CB2 0QQ, UK</aff>
            </contrib-group>
            <author-notes>
                <corresp id="c1">
                    <label>a</label>
                    <email xlink:href="mailto:lamenga-etego@ug.edu.gh">lamenga-etego@ug.edu.gh</email>
                </corresp>
                <corresp id="c2">
                    <label>b</label>
                    <email xlink:href="mailto:wh2@sanger.ac.uk">wh2@sanger.ac.uk</email>
                </corresp>
                <fn fn-type="conflict">
                    <p>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>24</day>
                <month>7</month>
                <year>2025</year>
            </pub-date>
            <pub-date pub-type="collection">
                <year>2025</year>
            </pub-date>
            <volume>9</volume>
            <elocation-id>49</elocation-id>
            <history>
                <date date-type="accepted">
                    <day>24</day>
                    <month>7</month>
                    <year>2025</year>
                </date>
            </history>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2025 Harrott AJR et al.</copyright-statement>
                <copyright-year>2025</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access article distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <self-uri content-type="pdf" xlink:href="https://gatesopenresearch.org/articles/9-49/pdf"/>
            <related-article ext-link-type="doi" id="related-article-version-17756" related-article-type="preprint" xlink:href="10.12688/verixiv.630.1"/>
            <abstract>
                <p>Malaria causes around 250 million cases and over 600,000 deaths annually, with the heaviest burden falling on young children living in sub-Saharan Africa. Molecular surveillance of 
                    <italic toggle="yes">Plasmodium</italic> parasites and 
                    <italic toggle="yes">Anopheles</italic> mosquito vectors are key components of effective malaria control decision-making. Previously, we have designed and implemented a nanopore-based workflow for targeted 
                    <italic toggle="yes">P. falciparum</italic> molecular surveillance in Ghana, which we call DRAG1 (drug resistance + antigen multiplex PCR). Here, we describe an updated and expanded multiplex assay (&#x2018;DRAG2&#x2019;) with additional amplicon targets that incorporate more antimalarial drug resistance markers, the polymorphic surface antigen 
                    <italic toggle="yes">merozoite surface protein 2</italic> (
                    <italic toggle="yes">msp2</italic>), and the 18S ribosomal RNA (rRNA) gene for 
                    <italic toggle="yes">Plasmodium</italic> species detection. We describe the performance of the DRAG2 assay over a range of parasitaemias and sample types (venous blood and dried blood spots), with suggested systems of quality control including the use of synthetic plasmids for positive controls and recommended coverage thresholds. The plasmids are highly economical, and engineered to include both &#x2018;test&#x2019; single nucleotide polymorphisms (SNPs), such as known drug resistance markers, and &#x2018;control&#x2019; SNPs, which are not found in nature and thus signal contamination if detected in clinical samples. We provide standard operating procedures (SOPs) for use by teams aiming to implement the assay in their laboratory. In summary, we describe an updated nanopore-based method for malaria molecular surveillance, including detailed consideration of quality control processes and SOPs. These are important steps in the transition from research tool to diagnostic assay, which will require further testing in endemic settings and regulatory processes and approvals.</p>
            </abstract>
            <abstract abstract-type="plain-language-summary">
                <title>Plain language summary</title>
                <p>Malaria is a major cause of disease and death globally, especially for young children living in Africa. Affected countries aim to reduce the spread of the malaria parasite, which is transmitted by mosquitoes, and to treat infected people using drugs. However, the parasites can develop resistance to the drugs, making them less effective. Newly approved malaria vaccines are also being deployed at scale. It is therefore important to monitor parasites for the development and spread of drug resistance and for any changes relevant to the vaccine, to ensure treatment outcomes remain optimal. This study describes a laboratory method for monitoring malaria parasites suitable for use in tropical areas where malaria is common. Starting from a blood sample taken from an infected person, targeted sections of malaria parasite DNA are amplified and sequenced using nanopore technology. The genes analysed provide information on drug resistance, the current vaccine target, and which malaria species are present. The study also describes laboratory practices to ensure high quality standards are maintained consistently. In summary, this study reports a method for monitoring malaria parasites using a streamlined DNA sequencing workflow; further work can assess its performance in malaria zones and develop protocols suitable for clinical use.</p>
            </abstract>
            <kwd-group kwd-group-type="author">
                <kwd>Malaria</kwd>
                <kwd>nanopore</kwd>
                <kwd>P. falciparum</kwd>
                <kwd>surveillance</kwd>
                <kwd>antimicrobial resistance</kwd>
                <kwd>AMR</kwd>
                <kwd>vaccine</kwd>
                <kwd>amplicon sequencing</kwd>
            </kwd-group>
            <funding-group>
                <award-group id="fund-1">
                    <funding-source>Gates Foundation</funding-source>
                    <award-id>INV-050873</award-id>
                </award-group>
                <award-group id="fund-2">
                    <funding-source>Gates Foundation</funding-source>
                    <award-id>INV-071074</award-id>
                </award-group>
                <award-group id="fund-3" xlink:href="https://doi.org/10.13039/501100000272">
                    <funding-source>National Institute for Health and Care Research</funding-source>
                </award-group>
                <award-group id="fund-4">
                    <funding-source>Gates Foundation</funding-source>
                    <award-id>INV-069387</award-id>
                </award-group>
                <award-group id="fund-5" xlink:href="https://doi.org/10.13039/100004440">
                    <funding-source>Wellcome Trust and the UK Foreign, Commonwealth &amp; Development Office</funding-source>
                    <award-id>223705/Z/21/Z</award-id>
                </award-group>
                <award-group id="fund-6">
                    <funding-source>Gates Foundation</funding-source>
                    <award-id>INV-068808</award-id>
                </award-group>
                <award-group id="fund-7">
                    <funding-source>Gates Foundation</funding-source>
                    <award-id>INV-052827</award-id>
                </award-group>
                <funding-statement>This work was funded by grant 223705/Z/21/Z to IG (jointly from Wellcome Trust and the UK Foreign, Commonwealth &amp; Development Office (FCDO)), the Gates Foundation (grants INV-050873, INV-052827, INV-069387, INV-071074, INV-068808), and the Wellcome Sanger Institute Genomic Surveillance Unit (GSU). WLH is funded by a National Institute for Health and Care Research (NIHR) clinical lectureship at Cambridge University. The funders played no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.</funding-statement>
                <funding-statement>
                    <italic>The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.</italic>
                </funding-statement>
            </funding-group>
        </article-meta>
    </front>
    <body>
        <sec id="sec3" sec-type="intro">
            <title>Introduction</title>
            <p>Malaria exacts a huge toll on human health globally, particularly for young children living in sub-Saharan Africa. There were 249 million malaria cases and 608,000 deaths in 2022 across 85 countries.
                <sup>
                    <xref ref-type="bibr" rid="ref1">1</xref>
                </sup> The number of cases in 2022 increased by five million compared to 2021. 95% of cases and deaths were in sub-Saharan Africa, and around four in five malaria deaths were children under five years old. Threats to malaria control include antimalarial drug resistance, deletions in the diagnostic target genes 
                <italic toggle="yes">hrp2</italic> and 
                <italic toggle="yes">hrp3</italic>, vector insecticide resistance, and the spread of invasive vector species. Continuous political will and investment to sustain and intensify control efforts is essential. A changing climate may further contribute to fluctuations in transmission dynamics in the coming years.</p>
            <p>Despite these challenges, there are multiple new interventions being added to the antimalarial armamentarium, including novel antimalarial drugs, long-acting monoclonal antibodies, the expansion of molecular systems of surveillance in endemic countries, and several vaccines. Currently, two malaria vaccines are recommended by the World Health Organization (WHO), RTS, S and R21, which both target circumsporozoite protein (PfCSP) in the most virulent malaria parasite species, 
                <italic toggle="yes">Plasmodium falciparum.</italic> Parasite populations are therefore being placed under a multitude of intense selection pressures, creating the ecological conditions that may drive the evolution of antimalarial drug resistance or possibly vaccine escape mutants. In this dynamic context, continuous surveillance of parasite populations forms a critical component of malaria control, allowing national malaria control programmes (NMCPs) to deploy their resources most effectively and respond quickly to heritable changes in the parasite that confer fitness against interventions.
                <sup>
                    <xref ref-type="bibr" rid="ref2">2</xref>
                </sup>
            </p>
            <p>Nanopore sequencing has been increasingly used to generate genetic data on 
                <italic toggle="yes">Plasmodium</italic> parasites, including in endemic countries, such as detecting antimalarial drug resistance markers, variation in the 
                <italic toggle="yes">csp</italic> gene sequence, 
                <italic toggle="yes">hrp2/3</italic> gene deletions, and population dynamics.
                <sup>
                    <xref ref-type="bibr" rid="ref3">3</xref>&#x2013;
                    <xref ref-type="bibr" rid="ref6">6</xref>
                </sup> Nanopore technology offers advantages including relatively low up-front costs, &#x2018;real-time&#x2019; sequencing, portability, scalability, and long sequence reads. Moreover, use of Oxford Nanopore Technologies (ONT) has expanded in malaria endemic countries during the Covid-19 pandemic, in efforts to increase global SARS-CoV-2 genomic surveillance.
                <sup>
                    <xref ref-type="bibr" rid="ref7">7</xref>
                </sup> However, significant challenges to implementation persist, including optimising sampling strategy, the low quality and quantity of parasite DNA generally retrieved from clinical samples, slow procurement processes in many endemic countries, and bioinformatics capacity (reviewed in Ref. 
                <xref ref-type="bibr" rid="ref8">8</xref>).</p>
            <p>Previously, we have developed and implemented a nanopore-based multiplex amplicon assay for 
                <italic toggle="yes">P. falciparum</italic> genomic surveillance in Ghana.
                <sup>
                    <xref ref-type="bibr" rid="ref5">5</xref>
                </sup> This assay had targets within six genes, five for monitoring antimalarial drug resistance (
                <italic toggle="yes">chloroquine resistance transporter</italic> (
                <italic toggle="yes">crt</italic>), 
                <italic toggle="yes">dihydrofolate reductase</italic> (
                <italic toggle="yes">dhfr</italic>), 
                <italic toggle="yes">dihydropteroate synthase</italic> (
                <italic toggle="yes">dhps</italic>), 
                <italic toggle="yes">multidrug resistance protein 1</italic> (
                <italic toggle="yes">mdr1</italic>), and 
                <italic toggle="yes">kelch13</italic>), and one for vaccine target surveillance (
                <italic toggle="yes">csp</italic>). We refer to this assay as &#x2018;DRAG1&#x2019; (drug resistance + antigen multiplex PCR). Here, we expand on this work by adding additional targets to the multiplex PCR, producing a new assay we refer to as &#x2018;DRAG2&#x2019;. We describe assay performance, quality control processes including coverage thresholds and use of synthetic plasmids as positive controls, and standard operating procedures (SOPs) for assay implementation.</p>
        </sec>
        <sec id="sec4" sec-type="methods">
            <title>Methods</title>
            <sec id="sec5">
                <title>DRAG2: An expanded multiplex PCR for malaria surveillance using nanopore sequencing</title>
                <p>The DRAG2 multiplex PCR builds on our previous iteration of the assay (&#x2018;DRAG1&#x2019;) by adding additional amplicons for the drug resistance genes 
                    <italic toggle="yes">crt</italic> and 
                    <italic toggle="yes">mdr1</italic>, the full-length 
                    <italic toggle="yes">merozoite surface protein 2</italic> (
                    <italic toggle="yes">msp2</italic>) gene, and a target within the small subunit of ribosomal rRNA genes that can distinguish between 
                    <italic toggle="yes">Plasmodium</italic> species. A summary of the amplicons is shown in 
                    <xref ref-type="table" rid="T1">
Table 1</xref> and Extended data (all supplementary materials for this project are freely available at: 
                    <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.6084/m9.figshare.28539320.v1">https://doi.org/10.6084/m9.figshare.28539320.v1</ext-link>).
                    <sup>
                        <xref ref-type="bibr" rid="ref27">27</xref>
                    </sup> We divided the assay into two separate multiplex reactions, which we refer to as DRAG2-A and DRAG2-B. This reduced the risk of primer interactions and increased target specificity. In addition to the drug resistance markers targeted in DRAG1, the expanded DRAG2 assay includes C-terminal sections of 
                    <italic toggle="yes">crt</italic> and 
                    <italic toggle="yes">mdr1</italic> (
                    <xref ref-type="table" rid="T2">
Table 2</xref>). Full-length 
                    <italic toggle="yes">msp2</italic> was included due to its polymorphism, with potential to act as an approximate indicator of multiplicity of infection (MOI) i.e. infections with multiple 
                    <italic toggle="yes">P. falciparum</italic> clones. While the assay is intended as a tool for 
                    <italic toggle="yes">P. falciparum</italic> molecular surveillance, the 18S rRNA gene target was included to detect mixed species infections or unintended non-

                    <italic toggle="yes">falciparum</italic> malaria samples; further details are provided below. The amplicon targets were designed to be more similar to each-other in size compared with DRAG1, to make sequencing coverage more even (average and standard deviation (SD) of amplicon sizes in the 3D7 reference genome for DRAG1 and DRAG2 assays are 586bp (SD 303bp) vs. 668bp (SD 166bp), respectively).</p>
                <table-wrap id="T1" orientation="portrait" position="float">
                    <label>
Table 1. </label>
                    <caption>
                        <title>Primer sequences and amplicon targets included in the DRAG2 assay.</title>
                        <p>The assay is divided into two multiplex PCR mixtures, DRAG2-A and DRAG2-B. Amplicon size is relative to the 3D7 reference genome. &#x2018;New&#x2019; refers to whether the primer sequences are new since the DRAG1 assay (already published), or were already included in DRAG1. Primer sequences are also shown in Supplementary Table 2.</p>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="left" colspan="1" rowspan="1" valign="top">DRAG2 assay</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Primer name</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Gene target</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Amplicon type</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Primer sequence</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Amplicon size (bp)</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">
New from DRAG1</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="left" colspan="1" rowspan="10" valign="top">A</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">kelch13 - F</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">kelch13</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Drug resistance</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">AAGCCTTGTTGAAAGAAGCA</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">868</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">No</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">kelch13 - R</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">kelch13</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Drug resistance</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">GGGAACTAATAAAGATGGGCC</td>
                                <td colspan="1" rowspan="1"/>
                                <td align="left" colspan="1" rowspan="1" valign="top">No</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">18S rRNA - F</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">18S rRNA</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Species detection</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CAATTGGAGGGCAAGTCTG</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">690 &amp; 748</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Yes</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">18S rRNA - R</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">18S rRNA</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Species detection</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CTTTTAACTTTCTCGCTTGCG</td>
                                <td colspan="1" rowspan="1"/>
                                <td align="left" colspan="1" rowspan="1" valign="top">Yes</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">crt-C - F</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">crt</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Drug resistance</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">ACCTTCGCATTGTTTTCCTTC</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">530</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Yes</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">crt-C - R</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">crt</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Drug resistance</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">AGTTACGAAATCTAATAATCTTGGTTC</td>
                                <td colspan="1" rowspan="1"/>
                                <td align="left" colspan="1" rowspan="1" valign="top">Yes</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">dhfr - F</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">dhfr</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Drug resistance</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">GTTTTCGATATTTATGCCATATGTG</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">490</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">No</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">dhfr - R</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">dhfr</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Drug resistance</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">TGATAAACAACGGAACCTCC</td>
                                <td colspan="1" rowspan="1"/>
                                <td align="left" colspan="1" rowspan="1" valign="top">No</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">mdr1-N - F</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">mdr1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Drug resistance</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CCGTTTAAATGTTTACCTGCAC</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">459</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Yes</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">mdr1-N - R</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">mdr1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Drug resistance</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">ACATAAAGTCAAACGTGCATTTT</td>
                                <td colspan="1" rowspan="1"/>
                                <td align="left" colspan="1" rowspan="1" valign="top">Yes</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="10" valign="top">B</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">csp - F</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">csp</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Antigen</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">TGGGAAACAGGAAAATTGGTAT</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">975</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">No</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">csp - R</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">csp</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Antigen</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">TACGACATTAAACACACTGGAA</td>
                                <td colspan="1" rowspan="1"/>
                                <td align="left" colspan="1" rowspan="1" valign="top">No</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">msp2 - F</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">msp2</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Antigen</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">TGAAAGTAAATATAGCAACACATTCAT</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">750</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Yes</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">msp2 - R</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">msp2</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Antigen</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">ATATGGCAAAAGATAAAACAAGTGT</td>
                                <td colspan="1" rowspan="1"/>
                                <td align="left" colspan="1" rowspan="1" valign="top">Yes</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">mdr1-C - F</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">mdr1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Drug resistance</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">TGTAAATGCAGCTTTATGGGG</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">703</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Yes</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">mdr1-C - R</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">mdr1</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Drug resistance</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CATGGGTTCTTGACTAACTATTGA</td>
                                <td colspan="1" rowspan="1"/>
                                <td align="left" colspan="1" rowspan="1" valign="top">Yes</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">dhps - F</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">dhps</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Drug resistance</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">TTTGTTGAACCTAAACGTGC</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">641</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">No</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">dhps - R</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">dhps</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Drug resistance</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">AACATTTTGATCATTCATGCAAT</td>
                                <td colspan="1" rowspan="1"/>
                                <td align="left" colspan="1" rowspan="1" valign="top">No</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">crt-N - F</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">crt</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Drug resistance</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">TGGAGGTTCTTGTCTTGGTA</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">494</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Yes</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">crt-N - R</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">crt</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Drug resistance</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">ACTGAACAGGCATCTAACATG</td>
                                <td colspan="1" rowspan="1"/>
                                <td align="left" colspan="1" rowspan="1" valign="top">Yes</td>
                            </tr>
                        </tbody>
                    </table>
                </table-wrap>
                <table-wrap id="T2" orientation="portrait" position="float">
                    <label>
Table 2. </label>
                    <caption>
                        <title>Specific drug resistance marker targets included in DRAG2 assay.</title>
                        <p>Red text indicates targets added in DRAG2 that are not included in DRAG1. Both DRAG1 and DRAG2 assays also include the region of 
                            <italic toggle="yes">kelch13</italic> in which artemisinin resistance mutations have been identified and the vaccine target 
                            <italic toggle="yes">csp.</italic>
                        </p>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="left" colspan="1" rowspan="1" valign="top">Gene name and ID in 3D7 reference</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Key mutations targeted for genotyping</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Associated antimalarial resistance</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="middle">Chloroquine resistance transporter, 
                                    <italic toggle="yes">crt</italic> (PF3D7_0709000)</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">N-terminal: K76T
                                    <break/>C-terminal: N326S, I356T</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">Chloroquine resistance marker</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="middle">Dihydrofolate reductase, 
                                    <italic toggle="yes">dhfr</italic> (PF3D7_0417200)</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">N51I, C59R, S108N, I164L</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">Pyrimethamine resistance markers</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="middle">Dihydropteroate synthase, 
                                    <italic toggle="yes">dhps</italic> (PF3D7_0810800)</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">S436A, A437G, K540E, A581G, A613S/T</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">Sulfadoxine resistance markers</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="middle">Multidrug resistance protein 1, 
                                    <italic toggle="yes">mdr1</italic> (PF3D7_0523000)</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">N-terminal: N86Y, N86F, Y184F
                                    <break/>C-terminal: S1034C, N1042D, D1246Y</td>
                                <td align="left" colspan="1" rowspan="1" valign="middle">No direct inferences, but associated with resistance to several antimalarials including lumefantrine</td>
                            </tr>
                        </tbody>
                    </table>
                </table-wrap>
            </sec>
            <sec id="sec6">
                <title>Primer design for multiplex PCR</title>
                <p>Primer design followed a similar process to,
                    <sup>
                        <xref ref-type="bibr" rid="ref5">5</xref>
                    </sup> using primer3 software
                    <sup>
                        <xref ref-type="bibr" rid="ref9">9</xref>&#x2013;
                        <xref ref-type="bibr" rid="ref11">11</xref>
                    </sup> to generate candidate primer sequences, followed by 
                    <italic toggle="yes">in silico</italic> checks for primer interactions with ThermoFisher Multiple Primer Analyzer,
                    <sup>
                        <xref ref-type="bibr" rid="ref12">12</xref>
                    </sup> and 
                    <italic toggle="yes">in vitro</italic> testing of primer combinations to identify high-performing combinations based on PCR product inspection by agarose gel electrophoresis and nanopore sequencing to determine gene target coverage profiles.</p>
                <p>For species detection, we chose the 18S rRNA gene because (1) this is already well described as a target for 
                    <italic toggle="yes">Plasmodium</italic> species detection
                    <sup>
                        <xref ref-type="bibr" rid="ref13">13</xref>&#x2013;
                        <xref ref-type="bibr" rid="ref15">15</xref>
                    </sup>; (2) 16S and18S gene amplicon sequencing is already well used and well understood in clinical microbiology practice as a molecular method of microbial identification
                    <sup>
                        <xref ref-type="bibr" rid="ref16">16</xref>
                    </sup>; (3) the multiple copies of 18S rRNA in the 
                    <italic toggle="yes">Plasmodium</italic> genome effectively increases the amount of template DNA present for amplification, which may increase sensitivity; (4) we found improved multiplex PCR performance if all primers targeted the nuclear genome, rather than adding mitochondrial targets for species detection to the same PCR reaction as nuclear genome targets, perhaps due to different AT-content and extremely different ploidy between the mitochondrial and nuclear genomes. 16S and 18S rRNA genes have sections of high sequence conservation interspersed with regions that vary between species, making them well suited for microbial identification via primers that target the more conserved regions. This approach is also well suited to the long sequence reads possible with ONT.</p>
                <p>Primer sequences (except for the 18S rRNA primers) were selected in conserved regions across high-quality 
                    <italic toggle="yes">P. falciparum</italic> genomes spanning wide geographic origins
                    <sup>
                        <xref ref-type="bibr" rid="ref17">17</xref>
                    </sup> based on multiple sequence alignments, and then screened for variants in the Pf7 MalariaGEN 
                    <italic toggle="yes">P. falciparum</italic> Community Project data resource.
                    <sup>
                        <xref ref-type="bibr" rid="ref18">18</xref>
                    </sup> For 18S rRNA primer design, publicly available 18S rRNA sequences from 
                    <italic toggle="yes">P. falciparum</italic>, 
                    <italic toggle="yes">P. vivax</italic>, 
                    <italic toggle="yes">P. ovale-curtisi
</italic>, 
                    <italic toggle="yes">P. ovale-wallikeri
</italic>, and 
                    <italic toggle="yes">P. knowlesi</italic> were aligned to identify conserved regions between all species for primer placement, containing regions that varied between species within the amplified sequence. The 18S rRNA primer pair chosen was not expected to amplify a product from the human genome (this was subsequently confirmed using a human gDNA sample).</p>
            </sec>
            <sec id="sec7">
                <title>Use of plasmid mixtures as positive controls</title>
                <p>Positive and negative controls are essential components of quality assurance in diagnostic microbiology. Negative controls should undergo the same end-to-end processes as test samples, including using the same reagents. This should identify reagent contamination, which could lead to false inferences by assigning contaminant genotypes to clinical samples (contamination risk is reduced by strict separation of pre- and post- PCR laboratory locations, pipettes and tips). Positive controls are required (1) to identify where problems are arising in a laboratory protocol; and (2) to confirm that the assay should have been able to detect a true positive (for example, if all test samples are negative). Positive control material could also form part of internal and external quality assurance processes; for example, by testing samples with known resistance genotypes and ensuring concordance, and investigating any discrepancies. Using 
                    <italic toggle="yes">P. falciparum</italic> genomic DNA as positive controls has several disadvantages, including: (1) a risk of clinical sample contamination, leading to false conclusions; (2) it can be slow and resource-intensive to culture 
                    <italic toggle="yes">P. falciparum</italic> parasites 
                    <italic toggle="yes">in vitro</italic> to generate gDNA material, requiring human erythrocytes and laboratory equipment; (3) it may be difficult or impossible to obtain parasites and/or genetic material that contain specific mutations to test assay performance, such as 
                    <italic toggle="yes">kelch13</italic> mutations found in non-culture adapted parasite lines; (4) non-

                    <italic toggle="yes">falciparum</italic> malaria species are difficult to culture and obtain genetic material, making positive controls for 
                    <italic toggle="yes">Plasmodium</italic> species identification challenging.</p>
                <p>We addressed these challenges by designing a system of synthetic plasmids for use as positive controls. The plasmids were purchased from a commercial company (GenScript) using a pUC57 vector background. Each plasmid contained a 
                    <italic toggle="yes">Plasmodium</italic> gene section targeted in the DRAG1 and DRAG2 PCRs, including the non-

                    <italic toggle="yes">falciparum</italic> 18S rRNA gene sequences Extended data; Supplementary Tables 3-4).
                    <sup>
                        <xref ref-type="bibr" rid="ref27">27</xref>
                    </sup> Each plasmid insert sequence was based on the 3D7 reference genome (or the corresponding non-

                    <italic toggle="yes">falciparum</italic> reference genomes for 18S rRNA genes), but modified in two ways: (1) &#x2018;test SNPs&#x2019; were added, consisting of known drug resistance mutations or other genetic changes the assay should detect; and (2) &#x2018;control SNPs&#x2019;, which were SNPs never found in nature (based on screening the Pf7 MalariaGEN data resource) and which result in amino acid substitutions with BLOSUM62 scores of -2 or below, suggesting they are biologically unlikely. Full details of test and control SNPs for the plasmid inserts are shown in Extended data; Supplementary Table 5),
                    <sup>
                        <xref ref-type="bibr" rid="ref27">27</xref>
                    </sup> and the fasta sequences are provided in Extended data.
                    <sup>
                        <xref ref-type="bibr" rid="ref27">27</xref>
                    </sup> At least two test SNPs and two control SNPs were added per insert sequence. It is extremely unlikely that two control SNPs would genuinely occur in a clinical sample; therefore, these SNPs act as markers of positive control contamination in clinical samples, and would facilitate contamination being quantified highly accurately from sequence read counts. Quality assurance systems could monitor for control contamination levels, with cut-offs to trigger investigation based on absolute read counts, relative read counts, and trends over time.</p>
                <p>200ug of each plasmid arrived from GenScript at a concentration of 1ug/ul in 200ul TE buffer. Each plasmid was diluted by a factor of 100 (to 10ng/ul) and combined accounting for their size to achieve the same number of moles per plasmid within the mixture. Inserts were not separated from the plasmid backbones. Five plasmid mixtures were created: mixture 1 contained plasmids with inserts spanning amplicon targets of 
                    <italic toggle="yes">dhfr</italic>, 
                    <italic toggle="yes">dhps</italic>, 
                    <italic toggle="yes">mdr1</italic>, 
                    <italic toggle="yes">kelch13</italic>, 
                    <italic toggle="yes">csp</italic>, and three 
                    <italic toggle="yes">P. falciparum</italic> 18S rRNA sequences (representing the amplicon diversity present in the five 
                    <italic toggle="yes">P. falciparum</italic> 18S rRNA genes present in the 3D7 reference genome). The remaining four mixtures contained mixture 1, plus: 2) 
                    <italic toggle="yes">P. malariae</italic> 18S, 3) 
                    <italic toggle="yes">P. ovale</italic> 18S, 4) a mixture of 
                    <italic toggle="yes">P. malariae</italic> and 
                    <italic toggle="yes">P. ovale</italic> 18S, and 5) 
                    <italic toggle="yes">P. vivax</italic> 18S, to represent mixed-species 
                    <italic toggle="yes">Plasmodium</italic> infections
                    <italic toggle="yes">.</italic> Serial dilutions were created for plasmid mixture 1, starting at 10ng/ul, to: 5ng/ul, 2.5ng/ul, 1ng/ul, and 0.5ng/ul. 2ul mixture 1 was added into the DRAG2 multiplex PCR assay (total reaction volume 25ul), i.e. total plasmid mixture masses added per 25ul PCR reaction were: 20ng, 10ng, 5ng, 2ng, and 1ng. From gel electrophoresis inspection, the first three concentrations (20ng, 10ng, and 5ng) produced all the expected bands with high intensity; some bands were faded at the lower concentrations. We opted to use the 20ng mixture going forwards, but would expect similar results down to at least 5ng. The plasmid cost is less than US$0.1 (10 US cents) per PCR reaction, and the 200ug starting quantity would be sufficient for at least 100,000 PCRs. 
                    <xref ref-type="fig" rid="f1">
Figure 1</xref> shows the DRAG1, DRAG2-A and DRAG2-B multiplex PCR products visualised by agarose gel electrophoresis using genomic DNA and the plasmid mixtures (20ng plasmid mass).</p>
                <fig fig-type="figure" id="f1" orientation="portrait" position="float">
                    <label>
Figure 1. </label>
                    <caption>
                        <title>Agarose gel electrophoresis of DRAG1 and DRAG2 multiplex PCRs.</title>
                        <p>DRAG1, DRAG2-A and DRAG2-B multiplex PCRs visualised by 2% agarose gel electrophoresis. Samples A-C use plasmid mixtures containing the inserts targeted in the assays at different concentrations; sample D is 
                            <italic toggle="yes">P. falciparum</italic> genomic DNA (laboratory clone DD2). The plasmid mixtures for samples A-C were, respectively: Mixture 1 containing the drug resistance and 
                            <italic toggle="yes">csp</italic> target regions plus three 
                            <italic toggle="yes">P. falciparum</italic> 18S rRNA sequences, Mixture 2 with added 
                            <italic toggle="yes">P. malariae</italic> 18S rRNA sequences
                            <italic toggle="yes">,
</italic> and Mixture 3 with added 
                            <italic toggle="yes">P. ovale</italic> 18S rRNA. All plasmids had been diluted to 10ng/ul with 2ul of plasmid mixtures added per PCR reaction (20ng total). &#x2018;-ve&#x2019; refers to nuclease free water template negative controls.</p>
                    </caption>
                    <graphic id="gr1" orientation="portrait" position="float" xlink:href="https://gatesopenresearch-files.f1000.com/manuscripts/17756/727b8b53-bde8-4f2e-abaf-cd0d92d18deb_figure1.gif"/>
                </fig>
                <p>Finally, the Oxford Nanopore Technologies (ONT) kit 14 native barcoding protocol (SQK-NBD114) also includes &#x2018;spike DNA&#x2019;, that functions as a positive control to confirm nanopore sequencing has worked for each barcode (separately from the PCRs, tested by the plasmid positive controls).</p>
            </sec>
            <sec id="sec8">
                <title>Clinical samples</title>
                <p>This study tested blood samples from clinical malaria patients recruited in Ghana, collected in Accra and in Navrongo in the Upper East Region. The samples were reported on previously in,
                    <sup>
                        <xref ref-type="bibr" rid="ref5">5</xref>
                    </sup> with a small number of additional samples from the same collection reported here. Patients were recruited into the study from LEKMA Hospital in Accra, and from community clinics and the War Memorial Hospital in Navrongo. Participants had symptoms compatible with malaria and tested positive for 
                    <italic toggle="yes">P. falciparum</italic> malaria by rapid diagnostic testing and microscopy. Participation required informed consent, and a detailed information sheet was provided. Samples collected included both leucodepleted venous blood (VB) and dried blood spots (DBS). Leucodepletion was performed by centrifugation and Buffy coat removal. Sample processing is described in more detail in.
                    <sup>
                        <xref ref-type="bibr" rid="ref5">5</xref>
                    </sup>
                </p>
                <p>To test the 18S amplicon for 
                    <italic toggle="yes">Plasmodium</italic> species identification, samples of 
                    <italic toggle="yes">P. vivax</italic>, 
                    <italic toggle="yes">P. ovale</italic> and 
                    <italic toggle="yes">P. malariae</italic> were selected based on microscopy findings. Five 
                    <italic toggle="yes">P. vivax</italic> samples were tested from patients in Laos. These samples were collected by the GenRe-Mekong study,
                    <sup>
                        <xref ref-type="bibr" rid="ref19">19</xref>
                    </sup> which performs genomic surveillance in five provinces of southern Laos. Collections were coordinated by the Center for Malariology, Parasitology, and Entomology (CMPE), Vientiane, Lao PDR, and Lao-Oxford-Mahosot Hospital-Wellcome Trust Research Unit (LOMRU), Vientiane, Lao PDR. The study is based at the Mahidol-Oxford Tropical Medicine Research Unit (MORU), Mahidol University, Bangkok. The 
                    <italic toggle="yes">P. ovale</italic> and 
                    <italic toggle="yes">P. malariae</italic> samples were collected from patients who presented with fever at two health facilities in Lom&#x00e9;, Togo, as part of an ongoing study of host-parasite interactions led by author LNA.</p>
            </sec>
            <sec id="sec9">
                <title>DNA extraction</title>
                <p>As in,
                    <sup>
                        <xref ref-type="bibr" rid="ref5">5</xref>
                    </sup> DNA extraction for the leucodepleted VB samples was undertaken using New England Labs Monarch High Molecular Weight (HMW) DNA extraction kit for cells and blood (T3050) according to the manufacturer protocol, and a subset of samples were extracted using the QIAmp DNA blood mini kit (51106) according to manufacturer instructions. DBS samples had been transferred from Ghana to the Wellcome Sanger Institute (WSI) and DNA was extracted using the QIAamp Investigator Biorobot kit on the Qiagen Biorobot Universal instrument. Further details are provided in Ref. 
                    <xref ref-type="bibr" rid="ref5">5</xref>.</p>
                <p>The non-

                    <italic toggle="yes">falciparum</italic> samples (
                    <italic toggle="yes">P. vivax</italic>, 
                    <italic toggle="yes">P. malariae</italic> and 
                    <italic toggle="yes">P. ovale</italic>) were DBS samples extracted using the QIAmp DNA blood mini kit (51106) according to manufacturer instructions.</p>
                <p>In summary, while this study made use of samples that had been extracted using HMW DNA extraction kits, both the DRAG1 and DRAG2 assays also work from DNA extracted using &#x2018;standard&#x2019; DNA extraction methods such as the QIAmp DNA blood mini kit. This is consistent with the fact that the largest amplicon fragment in either DRAG1 or DRAG2 assays is 
                    <italic toggle="yes">csp</italic>, around 1Kb in size.</p>
                <p>We have produced an end-to-end protocol for the &#x2018;wet lab&#x2019; components of the workflow, including details on DNA extraction, PCR, sample clean-up and ONT library preparation and sequencing, which is available in Extended data.
                    <sup>
                        <xref ref-type="bibr" rid="ref27">27</xref>
                    </sup>
                </p>
            </sec>
            <sec id="sec10">
                <title>PCR conditions</title>
                <p>The two multiplex PCR reaction mixtures (DRAG2-A and DRAG2-B) are shown in 
                    <xref ref-type="table" rid="T3">
Table 3</xref>, and the PCR conditions are shown in 
                    <xref ref-type="table" rid="T4">
Table 4</xref>.</p>
                <table-wrap id="T3" orientation="portrait" position="float">
                    <label>
Table 3. </label>
                    <caption>
                        <title>DRAG2 PCR reaction mixtures.</title>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="left" colspan="1" rowspan="1" valign="top">DRAG2A</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">x1 run (&#x03bc;L)</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">DRAG2B</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">
x1 run (&#x03bc;L)</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">5X HiFi Buffer</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">5</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">5X HiFi Buffer</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">5</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">10mM dNTP</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.75</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">10mM dNTP</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.75</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">kelch13</italic>- Forward</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.6</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">csp</italic>-Forward</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.75</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">kelch13</italic>- Reverse</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.6</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">csp</italic> -Reverse</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.75</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">18</italic>S -Forward</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.85</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">msp</italic>2-Foward</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.75</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">18S</italic>- Reverse</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.85</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">msp2</italic>-Reverse</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.75</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">crt-C-</italic> Forward</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.75</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">mdr1-C</italic>- Forward</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.6</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">crt-C
</italic>-Reverse</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.75</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">mdr1-C</italic>-Reverse</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.6</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">dhfr</italic>-Forward</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.75</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">dhps</italic>-Forward</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.6</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">dhfr</italic>-Reverse</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.75</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">dhps</italic>-Reverse</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.6</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">mdr1-N</italic>-Forward</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.5</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">crt-N
</italic>-Forward</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.6</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">mdr1-N</italic>-Reverse</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.5</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">crt-N
</italic>-Reverse</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.6</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Template DNA
                                    <xref ref-type="table-fn" rid="tfn1">*</xref>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <xref ref-type="table-fn" rid="tfn1">*</xref>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Template DNA 
                                    <xref ref-type="table-fn" rid="tfn1">*</xref>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <xref ref-type="table-fn" rid="tfn1">*</xref>
                                </td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">HiFi enzyme</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.5</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">HiFi enzyme</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.5</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Water (NFW)</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Add to final vol</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Water (NFW)</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Add to final vol</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <bold>Total</bold>
</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <bold>25</bold>
</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <bold>Total</bold>
</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <bold>25</bold>
</td>
                            </tr>
                        </tbody>
                    </table>
                    <table-wrap-foot>
                        <fn-group content-type="footnotes">
                            <fn id="tfn1">
                                <label>*</label>
                                <p>Volume of template DNA added depends on sample type (DBS, VB or plasmid control mixture). For DBS, typically we had concentrations after elution of 1-7 ng/ul, and we added 15ul per 25ul PCR reaction for both DRAG2-A and DRAG2-B. For leucodepleted VB, we had concentrations after elution of 2-500ng/ul and added 4ul sample per 25ul PCR reaction. The plasmid mixtures had been diluted to 10ng/ul and we added 2ul per 25ul PCR reaction.</p>
                            </fn>
                        </fn-group>
                    </table-wrap-foot>
                </table-wrap>
                <table-wrap id="T4" orientation="portrait" position="float">
                    <label>
Table 4. </label>
                    <caption>
                        <title>DRAG2 PCR thermocycler conditions.</title>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="left" colspan="1" rowspan="1" valign="top">Reaction conditions</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Temp</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Duration</th>
                                <th align="left" colspan="1" rowspan="1" valign="top"/>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Initial denaturation</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">95&#x00b0;C</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">3 min</td>
                                <td align="left" colspan="1" rowspan="5" valign="top">x35 cycles</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Denaturation</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">98&#x00b0;C</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">20 sec</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Annealing</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">60-65&#x00b0;C</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">15 sec</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Extension</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">72&#x00b0;C</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1 min</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Final extension</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">72&#x00b0;C</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">5 min</td>
                            </tr>
                        </tbody>
                    </table>
                </table-wrap>
            </sec>
            <sec id="sec11">
                <title>Library prep and nanopore sequencing</title>
                <p>All nanopore sequencing described in this study was undertaken using ONT kit 14 chemistry with R10.4.1 flow cells using the MinION Mk1B. The native barcoding kit SQK-NBD114.24 was used for library preparation, as per manufacturer instructions. We have also tested the 96-plex native barcoding protocol using SQK-NBD114.96 as per manufacturer instructions and achieved similar results, at higher throughput and therefore reduced cost per sample. MinKNOW software (version 23.11.2 &#x2013; 24.02.08) was used, running on commercially available high-performance &#x2018;gaming&#x2019; laptop computers with an NVIDIA RTX Graphics Processing Unit (GPU) of specification 3080 or higher, as in Ref. 
                    <xref ref-type="bibr" rid="ref5">5</xref>. For a batch of 24 samples running on a new MinION mk1b R10.4.1 flow cell, sequencing was stopped after 14 hours. Real-time base calling was performed via the MinKNOW software interface using the dorado base caller (version 7.2.11-7.3.11) on super accuracy mode.</p>
            </sec>
            <sec id="sec12">
                <title>Bioinformatic analysis</title>
                <p>Fastq files produced by sequencing and real-time base calling were processed using the nano-rave Nextflow pipeline (nanopore rapid analysis and variant explorer), as in Ref. 
                    <xref ref-type="bibr" rid="ref5">5</xref>. Nano-rave is available open-access via GitHub at: 
                    <ext-link ext-link-type="uri" xlink:href="https://github.com/sanger-pathogens/nano-rave">https://github.com/sanger-pathogens/nano-rave
</ext-link>. Briefly, nano-rave takes fastq files as input, maps the reads to reference sequences provided by the user using minimap2,
                    <sup>
                        <xref ref-type="bibr" rid="ref20">20</xref>
                    </sup> and performs variant calling with a user-selected choice of callers. In this study, the reference sequences provided were the coding sequences of genes targeted in the DRAG assays from the 
                    <italic toggle="yes">P. falciparum</italic> 3D7 reference genome, and the Clair3 variant caller was used with diploid genotypes.
                    <sup>
                        <xref ref-type="bibr" rid="ref21">21</xref>
                    </sup> An example nano-rave command line is shown below:</p>
                <disp-quote>
                    <p>nextflow run main.nf --sequencing_manifest./seq_manifest_name.csv --reference_manifest./ref_manifest_name.csv --variant_caller clair3 --clair3_args &#x201c;--model_path/opt/models/r941_prom_sup_g5014 --no_phasing_for_fa --include_all_ctgs&#x201d; --results_dir/output_directory -with-trace</p>
                </disp-quote>
                <p>Nano-rave generates three output files: coverage statistics using BEDTools, variant call files (vcfs) produced by the variant caller, and quality control (QC) metrics. Coverage data for each amplicon were used to assess assay performance and are presented in 
                    <xref ref-type="fig" rid="f2">Figures 2</xref>-
                    <xref ref-type="fig" rid="f3">3</xref>. vcf files were processed using a custom R script as in Ref. 
                    <xref ref-type="bibr" rid="ref5">5</xref>, with the following modification: the 
                    <italic toggle="yes">medaka-haploid
</italic>
                    <sup>
                        <xref ref-type="bibr" rid="ref22">22</xref>
                    </sup> variant caller was used in,
                    <sup>
                        <xref ref-type="bibr" rid="ref5">5</xref>
                    </sup> which infers haploid genotypes. We used the default diploid genotyping function of Clair3. Heterozygous genotypes (representing mixed infections) were then converted to haploid calls by using the majority allele (i.e. the allele present in &gt;51% of reads).</p>
                <p>For investigation of 
                    <italic toggle="yes">Plasmodium</italic> species, reads were mapped to the full-length genomes of 
                    <italic toggle="yes">P. falciparum</italic> 3D7 (Pf3D7_01_v3 version 2020-09-01), 
                    <italic toggle="yes">P. malariae</italic> (PmUG01_01_v1 version 2020-09-01), 
                    <italic toggle="yes">P. vivax</italic> (PvP01_01_v2 version 2020-09-01) and 
                    <italic toggle="yes">P. ovale</italic> (LT594505 version 2018-06-15) using minimap2. Mapped read pileups were inspected using the Integrative Genomics Viewer (IGV) software tool.
                    <sup>
                        <xref ref-type="bibr" rid="ref23">23</xref>
                    </sup> Bam files were manipulated using samtools.
                    <sup>
                        <xref ref-type="bibr" rid="ref24">24</xref>,
                        <xref ref-type="bibr" rid="ref25">25</xref>
                    </sup> The Bam-readcount tool was used to calculate read counts at each position. Plots were produced using pandas, seaborn and matplotlib.</p>
            </sec>
            <sec id="sec13">
                <title>Ethics</title>
                <p>As in Ref. 
                    <xref ref-type="bibr" rid="ref5">5</xref>, ethical approval for sample collection in Ghana was granted through the PAMGEN study (ethics approval ID: NHRCIRB343, obtained from the NHRC Institutional Review Board 31/05/2019), and via the EGSAT study (ethics ID: ECBAS030/21&#x2013;22, approved by the College of Basic and Applied Sciences Ethics Review Committee, University of Ghana, 20/12/2024). Ethical approval for the GenRe-Mekong study, from which the 
                    <italic toggle="yes">P. vivax</italic> samples were derived (collected in 2022 in Attapeu Province, Laos), was granted from the National Ethics Committee for Health Research (NECHR) of the Health Ministry of the Lao PDR, issued on 18
                    <sup>th</sup> August 2016. The Oxford Tropical Research Ethics Committee (OxTREC) approval for the study is dated 3
                    <sup>rd</sup> August 2016, amended 1
                    <sup>st</sup> August 2018. Ethical approval for the study from which the 
                    <italic toggle="yes">P. ovale</italic> and 
                    <italic toggle="yes">P. malariae</italic> samples were collected in Togo was obtained from Comit&#x00e9; de Bio&#x00e9;thique pour la Recherche en Sant&#x00e9; (CBRS), under the Ministry of Health, Public Hygiene, and Universal Access to Care (Opinion N&#x00b0; 045/2023/CBRS), 02/11/2023. Written informed consent was documented prior to enrolling patients into all the above studies. Approval was granted by the Wellcome Sanger Institute Research Ethics Committee and the study complied with all relevant ethical and research regulations.</p>
            </sec>
        </sec>
        <sec id="sec14" sec-type="results">
            <title>Results</title>
            <sec id="sec15">
                <title>Amplicon coverage profiles</title>
                <p>We tested the DRAG2 assay on 122 
                    <italic toggle="yes">P. falciparum</italic> clinical samples collected from Ghana; 34 were dried blood spots (DBS) and 88 were leucodepleted venous blood (VB). 95 samples were already reported in Ref. 
                    <xref ref-type="bibr" rid="ref5">5</xref>, with 27 new samples from the same study collections. The samples encompassed a wide range of parasitaemias as is commonly seen in clinical collections, from 1 parasite per 200 white blood cells (WBC) to 6378 parasites per 200 WBC, or from the limit of microscopy positivity to approximately 320,000 parasites per ul of blood. Amplicon coverage for the DRAG2 assay was more even than for DRAG1. Median coverage across all DRAG2 amplicon targets, including those that failed quality control (QC) filtering, was 10,727x (interquartile range (IQR), 3,745-24,774); including only QC-pass amplicons, median coverage was 11,781x (IQR, 4938-26,925). Coverage was lower for samples in the 0-40 parasites per 200 WBC range from DBS samples (
                    <xref ref-type="fig" rid="f2">
Figure 2</xref>), suggesting that 40 parasites per 200 WBC (or approximately 2000 parasites per ul of blood, or 0.1% infected red blood cells (RBCs)) may be a pragmatic cut-off for the DRAG2 assay from DBS samples. Coverage remained high for VB samples, even at the lowest parasitaemias tested.</p>
                <p>We analysed DRAG2 amplicon coverage for clinical samples, positive controls, and negative controls (
                    <xref ref-type="fig" rid="f3">
Figure 3</xref>). We established a pragmatic cut-off for clinical samples to be at least 7.5x the coverage of negative controls for each amplicon in the run to pass QC filters, on the basis that this would &#x201c;pass&#x201d; all the positive controls tested across multiple sequencing runs. We also used an absolute coverage threshold of 50x per amplicon, and if a sample has three or more amplicons that fail QC (out of the 10 amplicons in the assay) then the whole sample was failed. The poorest performing amplicon was for the 
                    <italic toggle="yes">dhps</italic> gene target, with 18 fails, whereas 
                    <italic toggle="yes">csp</italic> and 
                    <italic toggle="yes">msp2</italic> amplicons had no fails. Median coverage for each amplicon is shown in Extended data; Supplementary Table 6.
                    <sup>
                        <xref ref-type="bibr" rid="ref27">27</xref>
                    </sup> Seven samples (6%) were deemed to have failed QC on the basis of three or more failed amplicon targets, six DBS and one VB sample. These samples had low parasitaemias &#x2013; the six DBS had median parasitaemia of 3 parasites per 200 WBC (range 1-27), and the VB sample had 232 parasites per 200 WBC. As a further QC step, each variant needed at least 50x coverage for valid genotyping. While coverage was fairly even over each amplicon, it declined at the C-terminal end of the 
                    <italic toggle="yes">crt-C
</italic> amplicon, likely due to primer slippage in a nearby AT-rich intron.</p>
                <fig fig-type="figure" id="f2" orientation="portrait" position="float">
                    <label>
Figure 2. </label>
                    <caption>
                        <title>Coverage profile across all amplicons by parasitaemia.</title>
                    </caption>
                    <graphic id="gr2" orientation="portrait" position="float" xlink:href="https://gatesopenresearch-files.f1000.com/manuscripts/17756/727b8b53-bde8-4f2e-abaf-cd0d92d18deb_figure2.gif"/>
                </fig>
                <fig fig-type="figure" id="f3" orientation="portrait" position="float">
                    <label>
Figure 3. </label>
                    <caption>
                        <title>Coverage profile by amplicon.</title>
                        <p>Data across all parasitaemias tested for DBS and VB samples, for positive controls, negative controls, and clinical samples. Note that coverage appears lower for 
                            <italic toggle="yes">msp2</italic>, because reads were mapped competitively against both 3D7 and DD2 
                            <italic toggle="yes">msp2</italic> sequences, which encompass the main two allelic forms of 
                            <italic toggle="yes">msp2.</italic> The coverage shown for all amplicons depicts reads mapped to 3D7 sequences.</p>
                    </caption>
                    <graphic id="gr3" orientation="portrait" position="float" xlink:href="https://gatesopenresearch-files.f1000.com/manuscripts/17756/727b8b53-bde8-4f2e-abaf-cd0d92d18deb_figure3.gif"/>
                </fig>
            </sec>
            <sec id="sec16">
                <title>Drug resistance marker frequencies</title>
                <p>Drug resistance marker frequencies were calculated from the variants called from the amplicon sequence data (
                    <xref ref-type="table" rid="T5">
Table 5</xref>). These were consistent with the frequencies calculated from the DRAG1 assay reported in Ref. 
                    <xref ref-type="bibr" rid="ref5">5</xref>. No mutations associated with artemisinin partial resistance were identified in 
                    <italic toggle="yes">kelch13.</italic>
                </p>
                <table-wrap id="T5" orientation="portrait" position="float">
                    <label>
Table 5. </label>
                    <caption>
                        <title>Drug resistance marker counts for the DRAG2 assay.</title>
                        <p>Out of 122 samples, seven were excluded due to &#x2265;3 failed amplicons, giving N=116 samples. Individual amplicons were also excluded (QC criteria described in main text), so each amplicon has a different denominator. DRAG2 counts were tested for significance against expected proportions from the DRAG1 assay using Binomial exact test. Samples used for the DRAG1 and DRAG2 assay overlapped but with some samples unique to each assay. The SNP column shows the position of the SNP in the gene coding sequence in the 3D7 reference genome, and the base pair substitution. *
                            <italic toggle="yes">P</italic>&lt;0.05, **with Bonferroni correction for multiple comparisons, 0.05/11: &lt;0.005. No frequency comparisons were statistically significantly different between the DRAG1 and DRAG2 assays.</p>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="left" colspan="1" rowspan="1" valign="top">Gene</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">SNP</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Key Mutation (aa)</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">DRAG2 Frequency</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">DRAG1 Frequency (n=196)</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">

                                    <italic toggle="yes">P</italic>-value</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">crt</italic>
</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">227 A:C</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">K76T</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0/113</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1 (0.5%)</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">crt</italic>
</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">977 A:G</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">N326S</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0/105</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">NA</td>
                                <td colspan="1" rowspan="1"/>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">crt</italic>
</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1067 T:C</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">I356T</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0/105</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">NA</td>
                                <td colspan="1" rowspan="1"/>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">dhfr</italic>
</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">152 A:T</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">N51I</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">90/111(81.1%)</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">165 (84.2%)</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.3624</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">dhfr</italic>
</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">175 T:C</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">C59R</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">101/111(91.0%)</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">180 (91.8%)</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.7283</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">dhfr</italic>
</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">323 G:A</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">S108N</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">104/111(93.7%)</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">183 (93.4%)</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">dhfr</italic>
</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">323 G:C</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">S108T</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0/111</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0</td>
                                <td colspan="1" rowspan="1"/>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">dhfr</italic>
</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">490 A:T</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">I164L</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0/111</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0</td>
                                <td colspan="1" rowspan="1"/>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">dhfr</italic>
</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">492 A:G</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">I164M</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0/111</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0</td>
                                <td colspan="1" rowspan="1"/>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">dhps</italic>
</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1306 T:G</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">S436A</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">57/103(55.3%)</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">115 (58.7%)</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.4857</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">dhps</italic>
</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1307 C:T</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">S436F</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1/103 (1%)</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">3 (1.5%)</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">dhps</italic>
</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1310 G:C</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">A437G</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">89/103 (86.4%)</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">177 (90.3%)</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.1818</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">dhps</italic>
</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1618 A:G</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">K540E</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0/103</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0</td>
                                <td colspan="1" rowspan="1"/>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">dhps</italic>
</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1620 A:T</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">K540N</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0/103</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0</td>
                                <td colspan="1" rowspan="1"/>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">dhps</italic>
</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1742 C:G</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">A581G</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">2/103(1.9%)</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">4 (2.0%)</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">dhps</italic>
</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1837 G:T</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">A613S</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">13/103(12.6%)</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">27 (13.8%)</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.8862</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">dhps</italic>
</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">1837 G:A</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">A613T</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0/103</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0</td>
                                <td colspan="1" rowspan="1"/>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">mdr1</italic>
</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">256 A:T</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">N86Y</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">4/116(3.5%)</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">3 (1.5%)</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.09779</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">mdr1</italic>
</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">551 A:T</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Y184F</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">84/116(72.4%)</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">139 (70.9%)</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0.7601</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">mdr1</italic>
</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">3100 A:T</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">S1034C</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0/115</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">NA</td>
                                <td colspan="1" rowspan="1"/>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">mdr1</italic>
</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">3124 A:G</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">N1042D</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0/115</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">NA</td>
                                <td colspan="1" rowspan="1"/>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">mdr1</italic>
</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">3736 G:T</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">D1246Y</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">0/115</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">NA</td>
                                <td colspan="1" rowspan="1"/>
                            </tr>
                        </tbody>
                    </table>
                </table-wrap>
            </sec>
            <sec id="sec17">
                <title>

                    <italic toggle="yes">Plasmodium</italic> species detection</title>
                <p>We tested the 18S rRNA target for 
                    <italic toggle="yes">Plasmodium</italic> species detection in two ways. First, we used plasmid mixtures that included 18S rRNA sequences from 
                    <italic toggle="yes">P. falciparum</italic> (
                    <italic toggle="yes">Pf</italic>
), plus different combinations of 
                    <italic toggle="yes">P. malariae</italic> (
                    <italic toggle="yes">Pm</italic>), 
                    <italic toggle="yes">P. ovale</italic> (
                    <italic toggle="yes">Po</italic>), and 
                    <italic toggle="yes">P. vivax</italic> (
                    <italic toggle="yes">Pv</italic>) 18S rRNA sequences. We identified SNPs within the 18S rRNA sequences that were only found in their respective species, and counted the number of sequence reads containing these &#x2018;species-determining SNPs&#x2019; Extended data; Supplementary Table 7).
                    <sup>
                        <xref ref-type="bibr" rid="ref27">27</xref>
                    </sup> As expected, for &#x2018;pure&#x2019; 
                    <italic toggle="yes">P. falciparum</italic> plasmids, 99.15% reads mapping to the 3D7 18S rRNA sequence contained the 
                    <italic toggle="yes">Pf</italic>-determining SNPs (reflecting the accuracy of PCR and ONT sequencing). The mixtures contained approximately 2:1 ratios of 
                    <italic toggle="yes">Pf</italic> to non-

                    <italic toggle="yes">Pf</italic> plasmids, and accordingly the proportion of reads mapping to the 3D7 rRNA gene that contained the 
                    <italic toggle="yes">Pf</italic>-determining SNPs for these mixtures ranged from 62-81%, with the vast majority of remaining reads containing SNPs corresponding to the appropriate non-

                    <italic toggle="yes">Pf</italic> species (
                    <xref ref-type="fig" rid="f4">
Figure 4A</xref>). Next, we tested clinical DBS samples available from other studies that had been confirmed by microscopy as being 
                    <italic toggle="yes">Pf</italic> (from Ghana), 
                    <italic toggle="yes">Pm</italic> (Togo), 
                    <italic toggle="yes">Po</italic> (Togo), and 
                    <italic toggle="yes">Pv</italic> (Laos) (
                    <xref ref-type="fig" rid="f4">
Figure 4B</xref>), using only the 18S primers in singleplex reactions. Over 90% of reads mapping to the 
                    <italic toggle="yes">Pf</italic> 3D7 18S rRNA gene contained species-determining SNPs for the 
                    <italic toggle="yes">Pf</italic>, 
                    <italic toggle="yes">Pm</italic> and 
                    <italic toggle="yes">Pv</italic> samples (provided in Extended data; Supplementary Table 8)).
                    <sup>
                        <xref ref-type="bibr" rid="ref27">27</xref>
                    </sup> For the 
                    <italic toggle="yes">Po</italic> sample, 79% reads contained the 
                    <italic toggle="yes">Po</italic>-determining SNP and 21% contained a 
                    <italic toggle="yes">Pf</italic>-determining SNP; this may represent a mixed-species infection with low-level 
                    <italic toggle="yes">Pf</italic> parasitaemia. Reads were also mapped to their corresponding species reference genomes and inspected manually in IGV, and BLAST to confirm they were indeed the correct identity, matching the microscopy. These data suggest that the 18S rRNA gene target can be used as part of the DRAG2 multiplex panel to explore the prevalence of mixed 
                    <italic toggle="yes">Plasmodium</italic> species infections and the relative abundance of the non-

                    <italic toggle="yes">Pf</italic> species from clinical samples; and also functions as a stand-alone assay for 
                    <italic toggle="yes">Plasmodium</italic> species determination.</p>
                <fig fig-type="figure" id="f4" orientation="portrait" position="float">
                    <label>
Figure 4. </label>
                    <caption>
                        <title>Detection of 
                            <italic toggle="yes">Plasmodium</italic> species using &#x2018;species-determining SNPs&#x2019; from 18S rRNA amplicons.</title>
                        <p>Reads were first mapped to the 
                            <italic toggle="yes">Pf</italic> 18S rRNA sequence. (B) Species-determining SNP prevalence in clinical DBS: one 
                            <italic toggle="yes">P. falciparum</italic> (Ghana), one 
                            <italic toggle="yes">P. malariae</italic> (Togo), one P
                            <italic toggle="yes">. ovale</italic> (Togo), and five 
                            <italic toggle="yes">P. vivax</italic> (Laos).</p>
                    </caption>
                    <graphic id="gr4" orientation="portrait" position="float" xlink:href="https://gatesopenresearch-files.f1000.com/manuscripts/17756/727b8b53-bde8-4f2e-abaf-cd0d92d18deb_figure4.gif"/>
                </fig>
            </sec>
        </sec>
        <sec id="sec18" sec-type="discussion">
            <title>Discussion</title>
            <p>This study describes a method for malaria parasite molecular surveillance using targeted nanopore sequencing and a method to use plasmids as synthetic positive and negative controls for assay performance and quality controls. We build on our previous work,
                <sup>
                    <xref ref-type="bibr" rid="ref5">5</xref>
                </sup> expanding the targets in the multiplex PCR to include additional regions of the drug resistance genes 
                <italic toggle="yes">crt</italic> and 
                <italic toggle="yes">mdr1</italic>, full-length 
                <italic toggle="yes">msp2</italic>, and a section of the 18S rRNA gene to support 
                <italic toggle="yes">Plasmodium</italic> species identification. We have tested the method on blood samples from clinical malaria patients over a range of parasitaemias, using both leucodepleted venous blood (VB) and dried blood spots (DBS). The method does not involve a selective whole genome amplification (sWGA) step and instead works directly from DNA extracted from clinical samples, saving time and resources. The method is effective for VB down to the lowest microscopy-positive parasitaemias, though for DBS samples the coverage drops at parasitaemias below around 40 parasites per 200 white blood cells (the same coverage threshold commonly used for sWGA
                <sup>
                    <xref ref-type="bibr" rid="ref26">26</xref>
                </sup>). The assay can detect key drug resistance markers in the genes 
                <italic toggle="yes">crt</italic>, 
                <italic toggle="yes">dhfr</italic>, 
                <italic toggle="yes">dhps</italic>, and 
                <italic toggle="yes">mdr1</italic>; mutations in the propeller domain of 
                <italic toggle="yes">kelch13</italic> that are associated with artemisinin partial resistance; diversity in the 
                <italic toggle="yes">csp</italic> vaccine target and the polymorphic surface antigen 
                <italic toggle="yes">msp2</italic> &#x2013; which may be used as an approximate indicator of multiplicity of infection; and uses the 18S rRNA gene to identify 
                <italic toggle="yes">Plasmodium</italic> species. This straightforward workflow could therefore further enhance the ability of researchers in endemic settings to provide useful data to guide national malaria control programme decision-making. The full protocol is provided in Extended data,
                <sup>
                    <xref ref-type="bibr" rid="ref27">27</xref>
                </sup> presented as a Standard Operating Procedure (SOP) for laboratory use.</p>
            <p>We have used plasmids as positive control template DNA, engineering both &#x2018;test SNPs&#x2019; and &#x2018;control SNPs&#x2019; into the insert sequences. These plasmids can be used to confirm that the assay detects specific genetic markers of interest, such as drug resistance mutations (test SNPs), and simultaneously enable early detection of contamination of clinical samples by plasmid DNA (via the control SNPs). Because the control SNPs are extremely unlikely to occur in nature, and multiple SNPs are unlikely to arise by chance from sequencing error, contamination can be assessed on a read-by-read basis using this method, enabling absolute and relative thresholds and temporal trend data to trigger laboratory investigation for potential contamination. The plasmids are highly cost-effective, at around $0.1 (10 US cents) per PCR reaction, removing the need for gDNA from cultured parasites as positive controls. We also explored coverage cut-offs for quality control (QC) filtering, by determining the fold-changes in coverage for negative controls compared with clinical samples and plasmid positive controls. We suggest that for each amplicon, clinical samples should have at least 7.5x the coverage of the negative control to pass QC filters, in addition to an absolute threshold (for example, 50x coverage per amplicon). Another advantage is the ability to combine plasmids at precisely defined ratios, for example, to mimic mixed 
                <italic toggle="yes">Plasmodium</italic> species infections and 
                <italic toggle="yes">P. falciparum</italic> mixed clone infections. These features make plasmids well suited to assay quality assurance processes.</p>
            <p>This study has several limitations. The DRAG2 assay has been tested using a previously collected sample set from Ghana
                <sup>
                    <xref ref-type="bibr" rid="ref5">5</xref>
                </sup> and a small number of samples with non-

                <italic toggle="yes">falciparum</italic> malaria species, which did not include 
                <italic toggle="yes">P. knowlesi.</italic> The assay should be implemented as a practical workflow in laboratories based in malaria endemic countries to assess &#x2018;real world&#x2019; performance on a larger sample size.</p>
            <p>In conclusion, we have developed an expanded version of our previous multiplex assay for malaria molecular surveillance (MMS) using targeted nanopore sequencing; we provide assay validation data over a range of clinical sample types and parasitaemias, and described the use of engineered plasmid vectors for use as controls. A detailed SOP is provided in Extended data,
                <sup>
                    <xref ref-type="bibr" rid="ref27">27</xref>
                </sup> intended for use by laboratories adopting this workflow for MMS. Protocol standardisation, use of positive and negative controls, and systems of internal and external quality assurance (IQA and EQA) are essential components of assay quality assurance, which must be developed for malaria molecular surveillance to transition from a research tool to clinical and public health applications.</p>
        </sec>
        <sec id="sec19">
            <title>Author contributions</title>
            <p/>
            <table-wrap id="T6" orientation="portrait" position="anchor">
                <table content-type="article-table" frame="hsides">
                    <thead>
                        <tr>
                            <th align="left" colspan="1" rowspan="1" valign="top">Author name</th>
                            <th align="left" colspan="1" rowspan="1" valign="top">Contributions (CRediT)</th>
                        </tr>
                    </thead>
                    <tbody>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="middle">Alexandria J. R. Harrott</td>
                            <td align="left" colspan="1" rowspan="1" valign="middle">Data Curation, Formal Analysis, Investigation, Methodology, Validation, Visualization, Writing &#x2013; Review &amp; Editing</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="middle">Collins M. Morang'a</td>
                            <td align="left" colspan="1" rowspan="1" valign="middle">Data Curation, Formal Analysis, Investigation, Methodology, Project Administration, Writing &#x2013; Review &amp; Editing</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="middle">Richard D. Pearson</td>
                            <td align="left" colspan="1" rowspan="1" valign="middle">Formal Analysis, Supervision</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="middle">Mona-Liza Sakyi</td>
                            <td align="left" colspan="1" rowspan="1" valign="middle">Investigation</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="middle">Ahmed Osumanu</td>
                            <td align="left" colspan="1" rowspan="1" valign="middle">Investigation</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="middle">Enock K. Amoako</td>
                            <td align="left" colspan="1" rowspan="1" valign="middle">Investigation</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="middle">Fagd&#x00e9;ba David Bara</td>
                            <td align="left" colspan="1" rowspan="1" valign="middle">Investigation</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="middle">Myra Hosmillo</td>
                            <td align="left" colspan="1" rowspan="1" valign="middle">Investigation, Methodology, Project Administration</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="middle">Kess Rowe</td>
                            <td align="left" colspan="1" rowspan="1" valign="middle">Investigation, Project Administration</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="middle">Yaw Aniweh</td>
                            <td align="left" colspan="1" rowspan="1" valign="middle">Investigation, Supervision</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="middle">Gordon A. Awandare</td>
                            <td align="left" colspan="1" rowspan="1" valign="middle">Funding Acquisition</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="middle">Francis Zeukeng</td>
                            <td align="left" colspan="1" rowspan="1" valign="middle">Funding Acquisition, Supervision</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="middle">Ian Goodfellow</td>
                            <td align="left" colspan="1" rowspan="1" valign="middle">Funding Acquisition, Methodology, Supervision, Writing &#x2013; Review &amp; Editing</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="middle">Cristina V. Ariani</td>
                            <td align="left" colspan="1" rowspan="1" valign="middle">Funding Acquisition, Supervision</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="middle">Lucas N. Amenga-Etego
</td>
                            <td align="left" colspan="1" rowspan="1" valign="middle">Conceptualization, Data Curation, Formal Analysis, Funding Acquisition, Investigation, Methodology, Project Administration, Supervision, Validation, Visualization, Writing &#x2013; Review &amp; Editing</td>
                        </tr>
                        <tr>
                            <td align="left" colspan="1" rowspan="1" valign="middle">William L. Hamilton</td>
                            <td align="left" colspan="1" rowspan="1" valign="middle">Conceptualization, Data Curation, Formal Analysis, Funding Acquisition, Investigation, Methodology, Project Administration, Supervision, Validation, Visualization, Writing &#x2013; Original Draft Preparation, Writing &#x2013; Review &amp; Editing</td>
                        </tr>
                    </tbody>
                </table>
            </table-wrap>
        </sec>
    </body>
    <back>
        <sec id="sec22" sec-type="data-availability">
            <title>Data availability statement</title>
            <p>Nanopore sequence data for all samples analysed in this study is available via the European Nucleotide Archive (ENA), with sample codes provided in Supplementary Table 9. Prior to upload, reads were mapped to the 
                <italic toggle="yes">Plasmodium falciparum</italic> 3D7 v3.0 reference genome and only mapped reads were retained, to filter out human reads.</p>
            <p>Supplementary materials relating to this paper can be found here: Figshare: An expanded method for malaria parasite genetic surveillance using targeted nanopore sequencing. 
                <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.6084/m9.figshare.28539320.v1">https://doi.org/10.6084/m9.figshare.28539320.v1</ext-link>.
                <sup>
                    <xref ref-type="bibr" rid="ref27">27</xref>
                </sup>
            </p>
            <p>The project contains the following underlying data:
                <list list-type="order">
                    <list-item>
                        <label>1)</label>
                        <p>Supplementary Tables (1-9)</p>
                    </list-item>
                    <list-item>
                        <label>2)</label>
                        <p>Plasmid mix SOP.pdf</p>
                    </list-item>
                    <list-item>
                        <label>3)</label>
                        <p>DRAG lab SOP.pdf</p>
                    </list-item>
                    <list-item>
                        <label>4)</label>
                        <p>
plasmid_insert_seqs.zip</p>
                    </list-item>
                </list>
            </p>
            <p>Data are available under the terms of the 
                <ext-link ext-link-type="uri" xlink:href="https://creativecommons.org/licenses/by/4.0/">Creative Commons Attribution 4.0 International license</ext-link> (CC-BY 4.0).</p>
        </sec>
        <ack>
            <title>Acknowledgements</title>
            <p>Thanks to Prof Olivo Miotto (MORU, Thailand), Dr Nhien Nguyen Thanh Thuy (OUCRU, Vietnam), Dr Keobouphaphone Chindavongsa (CMPE, Vientiane, Laos) and the GenRe-Mekong team for supporting use of 
                <italic toggle="yes">P. vivax</italic> samples collected from Laos to test the 18S rRNA primers for 
                <italic toggle="yes">Plasmodium</italic> species detection. Thank you to Dr Jacob Garcia and Dr Chiyun Lee (Genomic Surveillance Unit, Wellcome Sanger Institute, UK) for support examining primer sequences for variants in the MalariaGEN Pf7 data resource. Thanks to Dr Victor Asoala and the staff of Navrongo Health Research Centre research laboratories and the sample donors.</p>
        </ack>
        <ref-list>
            <title>References</title>
            <ref id="ref1">
                <label>1</label>
                <mixed-citation publication-type="book">
                    <collab>World Health Organization</collab>:
                    <source>

                        <italic toggle="yes">World Malaria Report 2023.</italic>
</source>
                    <publisher-name>World Health Organization</publisher-name>;<year>2023</year>.</mixed-citation>
            </ref>
            <ref id="ref2">
                <label>2</label>
                <mixed-citation publication-type="other">
                    <collab>World Health Organization</collab>:
                    <article-title>Strategy to respond to antimalarial drug resistance in Africa.</article-title>
                    <year>2022 [cited 18 Nov 2022]</year>.
                    <ext-link ext-link-type="uri" xlink:href="https://www.who.int/publications/i/item/9789240060265">Reference Source</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref3">
                <label>3</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Runtuwene</surname>
                            <given-names>LR</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Tuda</surname>
                            <given-names>JSB</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Mongan</surname>
                            <given-names>AE</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Nanopore sequencing of drug-resistance-associated genes in malaria parasites, Plasmodium falciparum.</article-title>
                    <source>

                        <italic toggle="yes">Sci. Rep.</italic>
</source>
                    <year>2018</year>;<volume>8</volume>:<fpage>8213</fpage>&#x2013;<lpage>8286</lpage>.
                    <pub-id pub-id-type="pmid">29844487</pub-id>
                    <pub-id pub-id-type="doi">10.1038/s41598-018-26334-3</pub-id>
                    <pub-id pub-id-type="pmcid">PMC5974085</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref4">
                <label>4</label>
                <mixed-citation publication-type="other">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Razook</surname>
                            <given-names>Z</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Mehra</surname>
                            <given-names>S</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Gilchrist</surname>
                            <given-names>B</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Real time, field-deployable whole genome sequencing of malaria parasites using nanopore technology.</article-title>
                    <source>

                        <italic toggle="yes">bioRxiv.</italic>
</source>
                    <year>2020</year>. 2020.12.17.423341.
                    <ext-link ext-link-type="uri" xlink:href="https://www.biorxiv.org/content/10.1101/2020.12.17.423341v1%0Ahttps://www.biorxiv.org/content/10.1101/2020.12.17.423341v1.abstract">Reference Source</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref5">
                <label>5</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Girgis</surname>
                            <given-names>ST</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Adika</surname>
                            <given-names>E</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Nenyewodey</surname>
                            <given-names>FE</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Drug resistance and vaccine target surveillance of Plasmodium falciparum using nanopore sequencing in Ghana.</article-title>
                    <source>

                        <italic toggle="yes">Nat. Microbiol.</italic>
</source>
                    <year>2023</year>;<volume>8</volume>:<fpage>2365</fpage>&#x2013;<lpage>2377</lpage>.
                    <pub-id pub-id-type="pmid">37996707</pub-id>
                    <pub-id pub-id-type="doi">10.1038/s41564-023-01516-6</pub-id>
                    <pub-id pub-id-type="pmcid">PMC10686832</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref6">
                <label>6</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Cesare</surname>
                            <given-names>M</given-names>
                            <prefix>de</prefix>
                        </name>

                        <name name-style="western">
                            <surname>Mwenda</surname>
                            <given-names>M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Jeffreys</surname>
                            <given-names>AE</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Flexible and cost-effective genomic surveillance of P. falciparum malaria with targeted nanopore sequencing.</article-title>
                    <source>

                        <italic toggle="yes">Nat. Commun.</italic>
</source>
                    <year>2024</year>;<volume>15</volume>:<fpage>1413</fpage>.
                    <pub-id pub-id-type="pmid">38360754</pub-id>
                    <pub-id pub-id-type="doi">10.1038/s41467-024-45688-z</pub-id>
                    <pub-id pub-id-type="pmcid">PMC10869361</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref7">
                <label>7</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Tegally</surname>
                            <given-names>H</given-names>
                        </name>

                        <name name-style="western">
                            <surname>San</surname>
                            <given-names>JE</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Cotten</surname>
                            <given-names>M</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>The evolving SARS-CoV-2 epidemic in Africa: Insights from rapidly expanding genomic surveillance.</article-title>
                    <source>

                        <italic toggle="yes">Science (1979).</italic>
</source>
                    <year>2022</year>;<volume>378</volume>:<fpage>eabq5358</fpage>.
                    <pub-id pub-id-type="pmid">36108049</pub-id>
                    <pub-id pub-id-type="doi">10.1126/science.abq5358</pub-id>
                    <pub-id pub-id-type="pmcid">PMC9529057</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref8">
                <label>8</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Hamilton</surname>
                            <given-names>WL</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ishengoma</surname>
                            <given-names>DS</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Parr</surname>
                            <given-names>JB</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Nanopore sequencing for malaria molecular surveillance: opportunities and challenges.</article-title>
                    <source>

                        <italic toggle="yes">Trends Parasitol.</italic>
</source>
                    <year>2023</year>;<volume>39</volume>:<fpage>996</fpage>&#x2013;<lpage>1000</lpage>.
                    <pub-id pub-id-type="pmid">37865609</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.pt.2023.09.014</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref9">
                <label>9</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Koressaar</surname>
                            <given-names>T</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Remm</surname>
                            <given-names>M</given-names>
                        </name>
</person-group>:
                    <article-title>Enhancements and modifications of primer design program Primer3.</article-title>
                    <source>

                        <italic toggle="yes">Bioinformatics.</italic>
</source>
                    <year>2007</year>;<volume>23</volume>:<fpage>1289</fpage>&#x2013;<lpage>1291</lpage>.
                    <pub-id pub-id-type="pmid">17379693</pub-id>
                    <pub-id pub-id-type="doi">10.1093/bioinformatics/btm091</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref10">
                <label>10</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Untergasser</surname>
                            <given-names>A</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Cutcutache</surname>
                            <given-names>I</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Koressaar</surname>
                            <given-names>T</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Primer3-new capabilities and interfaces.</article-title>
                    <source>

                        <italic toggle="yes">Nucleic Acids Res.</italic>
</source>
                    <year>2012</year>;<volume>40</volume>:<fpage>e115</fpage>&#x2013;<lpage>e112</lpage>.
                    <pub-id pub-id-type="pmid">22730293</pub-id>
                    <pub-id pub-id-type="doi">10.1093/nar/gks596</pub-id>
                    <pub-id pub-id-type="pmcid">PMC3424584</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref11">
                <label>11</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>K&#x00f5;ressaar</surname>
                            <given-names>T</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Lepamets</surname>
                            <given-names>M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Kaplinski</surname>
                            <given-names>L</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Primer3-masker: Integrating masking of template sequence with primer design software.</article-title>
                    <source>

                        <italic toggle="yes">Bioinformatics.</italic>
</source>
                    <year>2018</year>;<volume>34</volume>:<fpage>1937</fpage>&#x2013;<lpage>1938</lpage>.
                    <pub-id pub-id-type="pmid">29360956</pub-id>
                    <pub-id pub-id-type="doi">10.1093/bioinformatics/bty036</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref12">
                <label>12</label>
                <mixed-citation publication-type="other">
                    <collab>ThermoFisher</collab>:
                    <article-title>Multiple Primer Analyzer.</article-title>
                    <year>[cited 16 Oct 2024]</year>.
                    <ext-link ext-link-type="uri" xlink:href="https://www.thermofisher.com/de/de/home/brands/thermo-scientific/molecular-biology/molecular-biology-learning-center/molecular-biology-resource-library/thermo-scientific-web-tools/multiple-primer-analyzer.html">Reference Source</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref13">
                <label>13</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Cnops</surname>
                            <given-names>L</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Jacobs</surname>
                            <given-names>J</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Van Esbroeck</surname>
                            <given-names>M</given-names>
                        </name>
</person-group>:
                    <article-title>Validation of a four-primer real-time PCR as a diagnostic tool for single and mixed Plasmodium infections.</article-title>
                    <source>

                        <italic toggle="yes">Clin. Microbiol. Infect.</italic>
</source>
                    <year>2011</year>;<volume>17</volume>:<fpage>1101</fpage>&#x2013;<lpage>1107</lpage>.
                    <pub-id pub-id-type="pmid">20718798</pub-id>
                    <pub-id pub-id-type="doi">10.1111/j.1469-0691.2010.03344.x</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref14">
                <label>14</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Rougemont</surname>
                            <given-names>M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Van Saanen</surname>
                            <given-names>M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Sahli</surname>
                            <given-names>R</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Detection of four Plasmodium species in blood from humans by 18S rRNA gene subunit-based and species-specific real-time PCR assays.</article-title>
                    <source>

                        <italic toggle="yes">J. Clin. Microbiol.</italic>
</source>
                    <year>2004</year>;<volume>42</volume>:<fpage>5636</fpage>&#x2013;<lpage>5643</lpage>.
                    <pub-id pub-id-type="pmid">15583293</pub-id>
                    <pub-id pub-id-type="doi">10.1128/JCM.42.12.5636-5643.2004</pub-id>
                    <pub-id pub-id-type="pmcid">PMC535226</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref15">
                <label>15</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Aime&#x00e9;</surname>
                            <given-names>KK</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Lengu</surname>
                            <given-names>TB</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Nsibu</surname>
                            <given-names>CN</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Molecular detection and species identification of Plasmodium spp. infection in adults in the Democratic Republic of Congo: A populationbased study.</article-title>
                    <source>

                        <italic toggle="yes">PLoS One.</italic>
</source>
                    <year>2020</year>;<volume>15</volume>:<fpage>15</fpage>.
                    <pub-id pub-id-type="pmid">33227017</pub-id>
                    <pub-id pub-id-type="doi">10.1371/journal.pone.0242713</pub-id>
                    <pub-id pub-id-type="pmcid">PMC7682816</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref16">
                <label>16</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Aggarwal</surname>
                            <given-names>D</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Rajan</surname>
                            <given-names>D</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Bellis</surname>
                            <given-names>KL</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Optimization of high-throughput 16S rRNA gene amplicon sequencing: an assessment of PCR pooling, mastermix use and contamination.</article-title>
                    <source>

                        <italic toggle="yes">Microb. Genom.</italic>
</source>
                    <year>2023</year>;<volume>9</volume>:<fpage>9</fpage>.
                    <pub-id pub-id-type="pmid">37843887</pub-id>
                    <pub-id pub-id-type="doi">10.1099/mgen.0.001115</pub-id>
                    <pub-id pub-id-type="pmcid">PMC10634443</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref17">
                <label>17</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Otto</surname>
                            <given-names>TD</given-names>
                        </name>

                        <name name-style="western">
                            <surname>B&#x00f6;hme</surname>
                            <given-names>U</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Sanders</surname>
                            <given-names>M</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Long read assemblies of geographically dispersed Plasmodium falciparum isolates reveal highly structured subtelomeres [version 1; referees: 3 approved].</article-title>
                    <source>

                        <italic toggle="yes">Wellcome Open Res.</italic>
</source>
                    <year>2018</year>;<volume>3</volume>:<fpage>52</fpage>.
                    <pub-id pub-id-type="pmid">29862326</pub-id>
                    <pub-id pub-id-type="doi">10.12688/wellcomeopenres.14571.1</pub-id>
                    <pub-id pub-id-type="pmcid">PMC5964635</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref18">
                <label>18</label>
                <mixed-citation publication-type="journal">
                    <collab>MalariaGEN</collab>:
                    <article-title>Pf7: an open dataset of Plasmodium falciparum genome variation in 20,000 worldwide samples.</article-title>
                    <source>

                        <italic toggle="yes">Wellcome Open Res.</italic>
</source>
                    <year>2023</year>;<volume>8</volume>:<fpage>22</fpage>.
                    <pub-id pub-id-type="pmid">36864926</pub-id>
                    <pub-id pub-id-type="doi">10.12688/wellcomeopenres.18681.1</pub-id>
                    <pub-id pub-id-type="pmcid">PMC9971654</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref19">
                <label>19</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Jacob</surname>
                            <given-names>CG</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Thuy-nhien</surname>
                            <given-names>N</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Mayxay</surname>
                            <given-names>M</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Genetic surveillance in the Greater Mekong subregion and South Asia to support malaria control and elimination.</article-title>
                    <source>

                        <italic toggle="yes">elife.</italic>
</source>
                    <year>2021</year>;<volume>10</volume>:<fpage>e62997</fpage>.
                    <pub-id pub-id-type="pmid">34372970</pub-id>
                    <pub-id pub-id-type="doi">10.7554/eLife.62997</pub-id>
                    <pub-id pub-id-type="pmcid">PMC8354633</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref20">
                <label>20</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Li</surname>
                            <given-names>H</given-names>
                        </name>
</person-group>:
                    <article-title>Minimap2: Pairwise alignment for nucleotide sequences.</article-title>
                    <source>

                        <italic toggle="yes">Bioinformatics.</italic>
</source>
                    <year>2018</year>;<volume>34</volume>:<fpage>3094</fpage>&#x2013;<lpage>3100</lpage>.
                    <pub-id pub-id-type="pmid">29750242</pub-id>
                    <pub-id pub-id-type="doi">10.1093/bioinformatics/bty191</pub-id>
                    <pub-id pub-id-type="pmcid">PMC6137996</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref21">
                <label>21</label>
                <mixed-citation publication-type="other">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Luo</surname>
                            <given-names>R</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Zheng</surname>
                            <given-names>Z</given-names>
                        </name>
</person-group>:
                    <article-title>Clair3 - Symphonizing pileup and full-alignment for high-performance long-read variant calling.</article-title>
                    <year>2021</year>.
                    <ext-link ext-link-type="uri" xlink:href="https://github.com/HKU-BAL/Clair3">Reference Source</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref22">
                <label>22</label>
                <mixed-citation publication-type="other">
                    <collab>nanoporetech</collab>:
                    <article-title>medaka.</article-title>
                    <year>2021 [cited 11 Oct 2024]</year>.
                    <ext-link ext-link-type="uri" xlink:href="https://github.com/nanoporetech/medaka">Reference Source</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref23">
                <label>23</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Robinson</surname>
                            <given-names>JT</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Thorvaldsd&#x00f3;ttir</surname>
                            <given-names>H</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Winckler</surname>
                            <given-names>W</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Integrative Genome Viewer.</article-title>
                    <source>

                        <italic toggle="yes">Nat. Biotechnol.</italic>
</source>
                    <year>2011</year>;<volume>29</volume>:<fpage>24</fpage>&#x2013;<lpage>26</lpage>.
                    <pub-id pub-id-type="pmid">21221095</pub-id>
                    <pub-id pub-id-type="doi">10.1038/nbt.1754.Integrative</pub-id>
                    <pub-id pub-id-type="pmcid">PMC3346182</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref24">
                <label>24</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Li</surname>
                            <given-names>H</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Handsaker</surname>
                            <given-names>B</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Wysoker</surname>
                            <given-names>A</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>The Sequence Alignment/Map format and SAMtools.</article-title>
                    <source>

                        <italic toggle="yes">Bioinformatics.</italic>
</source>
                    <year>2009</year>;<volume>25</volume>:<fpage>2078</fpage>&#x2013;<lpage>2079</lpage>.
                    <pub-id pub-id-type="pmid">19505943</pub-id>
                    <pub-id pub-id-type="doi">10.1093/bioinformatics/btp352</pub-id>
                    <pub-id pub-id-type="pmcid">PMC2723002</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref25">
                <label>25</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Danecek</surname>
                            <given-names>P</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Bonfield</surname>
                            <given-names>JK</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Liddle</surname>
                            <given-names>J</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Twelve years of SAMtools and BCFtools.</article-title>
                    <source>

                        <italic toggle="yes">Gigascience.</italic>
</source>
                    <year>2021</year>;<volume>10</volume>:<fpage>10</fpage>.
                    <pub-id pub-id-type="pmid">33590861</pub-id>
                    <pub-id pub-id-type="doi">10.1093/gigascience/giab008</pub-id>
                    <pub-id pub-id-type="pmcid">PMC7931819</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref26">
                <label>26</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Oyola</surname>
                            <given-names>SO</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ariani</surname>
                            <given-names>CV</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Hamilton</surname>
                            <given-names>WL</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Whole genome sequencing of Plasmodium falciparum from dried blood spots using selective whole genome amplification.</article-title>
                    <source>

                        <italic toggle="yes">Malar. J.</italic>
</source>
                    <year>2016</year>;<volume>15</volume>:<fpage>597</fpage>.
                    <pub-id pub-id-type="pmid">27998271</pub-id>
                    <pub-id pub-id-type="doi">10.1186/s12936-016-1641-7</pub-id>
                    <pub-id pub-id-type="pmcid">PMC5175302</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref27">
                <label>27</label>
                <mixed-citation publication-type="data">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Hamilton</surname>
                            <given-names>W</given-names>
                        </name>
</person-group>:
                    <data-title>Supplementary data for DRAG2 project.</data-title>Dataset.
                    <source>

                        <italic toggle="yes">figshare.</italic>
</source>
                    <year>2025</year>.
                    <pub-id pub-id-type="doi">10.6084/m9.figshare.28539320.v1</pub-id>
                </mixed-citation>
            </ref>
        </ref-list>
    </back>
</article>
