<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.2 20190208//EN" "http://jats.nlm.nih.gov/publishing/1.2/JATS-journalpublishing1.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" article-type="research-article" dtd-version="1.2" xml:lang="en">
    <front>
        <journal-meta>
            <journal-id journal-id-type="pmc">Gates Open Res</journal-id>
            <journal-title-group>
                <journal-title>Gates Open Research</journal-title>
            </journal-title-group>
            <issn pub-type="epub">2572-4754</issn>
            <publisher>
                <publisher-name>F1000 Research Limited</publisher-name>
                <publisher-loc>London, UK</publisher-loc>
            </publisher>
        </journal-meta>
        <article-meta>
            <article-id pub-id-type="doi">10.12688/gatesopenres.16245.1</article-id>
            <article-categories>
                <subj-group subj-group-type="heading">
                    <subject>Research Article</subject>
                </subj-group>
                <subj-group>
                    <subject>Articles</subject>
                </subj-group>
            </article-categories>
            <title-group>
                <article-title>Cloning, recombinant expression, and characterization of a 
                    <italic>Rhipicephalus microplus</italic> carboxylesterase.</article-title>
                <fn-group content-type="pub-status">
                    <fn>
                        <p>[version 1; peer review: 3 approved, 1 not approved]</p>
                    </fn>
                </fn-group>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author" corresp="yes">
                    <name>
                        <surname>Labuschagne</surname>
                        <given-names>Michel</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Conceptualization</role>
                    <role content-type="http://credit.niso.org/">Data Curation</role>
                    <role content-type="http://credit.niso.org/">Formal Analysis</role>
                    <role content-type="http://credit.niso.org/">Funding Acquisition</role>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Project Administration</role>
                    <role content-type="http://credit.niso.org/">Validation</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Original Draft Preparation</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <uri content-type="orcid">https://orcid.org/0000-0001-7758-3855</uri>
                    <xref ref-type="corresp" rid="c1">a</xref>
                    <xref ref-type="aff" rid="a1">1</xref>
                    <xref ref-type="aff" rid="a2">2</xref>
                    <xref ref-type="aff" rid="a3">3</xref>
                </contrib>
                <aff id="a1">
                    <label>1</label>Research Innovation, Clinglobal, Tamarin, 90903, Mauritius</aff>
                <aff id="a2">
                    <label>2</label>Research Innovation, Clinomics, Bloemfontein, Free State, 9338, South Africa</aff>
                <aff id="a3">
                    <label>3</label>Department of Microbiology and Biochemistry, University of the Free State Faculty of Natural and Agricultural Sciences, Bloemfontein, Free State, 9300, South Africa</aff>
            </contrib-group>
            <author-notes>
                <corresp id="c1">
                    <label>a</label>
                    <email xlink:href="mailto:michel.labuschagne@clinglobal.com">michel.labuschagne@clinglobal.com</email>
                </corresp>
                <fn fn-type="conflict">
                    <p>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>19</day>
                <month>8</month>
                <year>2024</year>
            </pub-date>
            <pub-date pub-type="collection">
                <year>2024</year>
            </pub-date>
            <volume>8</volume>
            <elocation-id>87</elocation-id>
            <history>
                <date date-type="accepted">
                    <day>13</day>
                    <month>8</month>
                    <year>2024</year>
                </date>
            </history>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2024 Labuschagne M</copyright-statement>
                <copyright-year>2024</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access article distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <self-uri content-type="pdf" xlink:href="https://gatesopenresearch.org/articles/8-87/pdf"/>
            <abstract>
                <sec>
                    <title>Background</title>
                    <p>The 
                        <italic toggle="yes">Rhipicephalus microplus</italic> carboxylesterase (CBE) is involved in synthetic pyrethroid (SP) hydrolysis and historic evidence suggests that a non-synonymous mutation (Asp374Asn) in CBE is associated with increased resistance towards SP-based acaricides. Functional expression and characterization of the wild-type and mutant CBE is required to understand the impact of the mutation on SP-based resistance.</p>
                </sec>
                <sec>
                    <title>Methods</title>
                    <p>The 
                        <italic toggle="yes">R. microplus</italic> CBE gene was cloned and functionally expressed in 
                        <italic toggle="yes">Pichia pastoris</italic> following the removal of the native signal peptide. Site directed mutagenesis was used to introduce the Asp374Asn substitution.</p>
                </sec>
                <sec>
                    <title>Results</title>
                    <p>Functional expression, characterization, and purification of both wild-type and mutant 
                        <italic toggle="yes">R. microplus</italic> CBE proteins was achieved using affinity chromatography under native conditions.</p>
                </sec>
                <sec>
                    <title>Conclusions</title>
                    <p>This report provides the necessary information for the tick research community to produce recombinant tick derived CBE proteins and to characterize the recombinant proteins towards substrates of interest.</p>
                </sec>
            </abstract>
            <kwd-group kwd-group-type="author">
                <kwd>Rhipicephalus microplus; Carboxylesterase; Recombinant expression; Purification; Resistance; Pichia pastoris</kwd>
            </kwd-group>
            <funding-group>
                <award-group id="fund-1">
                    <funding-source>Gates Foundation Funding</funding-source>
                    <award-id>OPP1213344</award-id>
                </award-group>
                <funding-statement>This work was supported by the Gates Foundation [OPP1213344].</funding-statement>
                <funding-statement>
                    <italic>The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.</italic>
                </funding-statement>
            </funding-group>
        </article-meta>
    </front>
    <body>
        <sec sec-type="intro">
            <title>Introduction</title>
            <p>The Asian blue tick 
                <italic toggle="yes">Rhipicephalus microplus</italic> is an economically important tick responsible for significant economic losses in the cattle industry
                <sup>
                    <xref ref-type="bibr" rid="ref-1">1</xref>
                </sup>. Chemical control strategies have been used effectively since the 1950s to manage tick populations. However, 
                <italic toggle="yes">R. microplus</italic> populations have developed resistance to all the classes of commercial acaricides currently in use. Resistance mechanisms to acaricides can be classified into affinity differences for target binding, enhanced acaricide degradation, and reduced acaricide acquisition from the environment
                <sup>
                    <xref ref-type="bibr" rid="ref-2">2</xref>
                </sup>. Synthetic pyrethroids (SPs) are one of the major classes of acaricides, accounting for approximately 17% of the total insecticide market in 2007, with annual sales exceeding USD 1.5 billion
                <sup>
                    <xref ref-type="bibr" rid="ref-3">3</xref>
                </sup>. SP resistance mechanisms have been identified, with sodium channel 
                <italic toggle="yes">kdr</italic> mutations being the most prevalent in SP-resistant phenotypes
                <sup>
                    <xref ref-type="bibr" rid="ref-4">4</xref>,
                    <xref ref-type="bibr" rid="ref-5">5</xref>
                </sup>. Another resistance mechanism in which SP is enzymatically hydrolyzed by 
                <italic toggle="yes">R. microplus</italic> carboxylesterase (RmCBE) was reported by Jamroz and coworkers
                <sup>
                    <xref ref-type="bibr" rid="ref-6">6</xref>
                </sup>, and the occurrence of an Asp374Asn-encoded mutation in RmCBE was statistically linked to SP resistance (Guerrero 
                <italic toggle="yes">et al</italic>., 2002). Differential gene expression between isolates was ruled out as a factor contributing to resistance, but attempts to produce enough active recombinant RmCBE in 
                <italic toggle="yes">Escherichia coli</italic> and 
                <italic toggle="yes">Pichia pastoris</italic> for the characterization of both the wild-type and mutant versions were unsuccessful
                <sup>
                    <xref ref-type="bibr" rid="ref-7">7</xref>
                </sup>. Translational analysis of acaricide resistance targets from LPT isolates indicated the presence of the Asp374Asn mutation in 14 out of 16 synthetic pyrethroid-resistant isolates from East and West Africa (manuscript in preparation). The recombinant expression, purification, and characterization of the wild-type and mutant versions of this carboxylesterase will provide evidence on whether the mutant version results in increased activity toward a range of synthetic pyrethroids and organophosphates.</p>
            <p>The heterologous expression of recombinant proteins enables controlled production under standard parameters and allows for the addition of sequences for standardized downstream purification of recombinant proteins. 
                <italic toggle="yes">Pichia pastoris</italic> is an attractive recombinant heterologous host due to its ability to secrete recombinant proteins into the extracellular medium
                <sup>
                    <xref ref-type="bibr" rid="ref-8">8</xref>
                </sup>. Although it has been used to produce active RmCBE, this process has resulted in low yields even after significant optimization
                <sup>
                    <xref ref-type="bibr" rid="ref-7">7</xref>
                </sup>.</p>
            <p>We attempted to express the complete open reading frame (ORF) encoding RmCBE using 
                <italic toggle="yes">P. pastoris</italic> with different signal peptides (&#x03b1;-factor and putative native RmCBE signal peptide) but were unable to produce detectable recombinant protein by SDS&#x2012;PAGE. Finally, we removed the putative native signal peptide of RmCBE, fused the putative mature protein with the &#x03b1;-factor signal peptide, and drove recombinant expression using the methanol-inducible 
                <italic toggle="yes">AOX1</italic> promoter in 
                <italic toggle="yes">P. pastoris</italic>.</p>
        </sec>
        <sec sec-type="methods">
            <title>Methods</title>
            <sec>
                <title>Cloning and sequencing of RmCBE</title>
                <p>All oligonucleotides used in this study were obtained from either IDT or Inqaba Biotechnical Industries. Restriction and DNA modification enzymes were obtained from either New England Biolabs or Thermo Fisher Scientific. Standard molecular biological techniques were performed according to the manufacturer&#x2019;s recommendations. Total genomic DNA (isolated from the Clinvet South Africa-susceptible 
                    <italic toggle="yes">R. microplus</italic> isolate) served as a template for 3 sets of PCR primers to amplify the full ORF of the RmCBE. The primer sets Rm_CBE_E1-1F(EcoRI) + Rm_CBE_E1-1R; Rm_CBE_E2-1F + Rm_CBE_E2-1R; and Rm_CBE_E3-1F + Rm_CBE_E3-1R (XbaI) (
                    <xref ref-type="table" rid="T1">Table 1</xref>) were used to amplify the 3 exons encoding the full ORF using Thermo Scientific&#x2122; Phusion Plus PCR Master Mix according to the manufacturer&#x2019;s instructions (Thermo Fisher Scientific; Catalogue number: F631S). The PCR products were analyzed using agarose gel electrophoresis, and the expected PCR products were excised from the gel and purified using the GeneJET Gel Extraction and DNA Cleanup Micro Kit (Thermo Fisher Scientific; Catalogue number: K0831). The purified PCR products were phosphorylated, followed by ligation of E1 and E2. This product served as template during the next round of PCR using the primers Rm_CBE_E1-1F (EcoRI) and Rm_CBE_E2-1R to amplify the fusion between E1 and E2. The fused product was gel-purified, phosphorylated, and ligated to phosphorylated E3, followed by PCR amplification using the primers Rm_CBE_E1-1F (EcoRI) and Rm_CBE_E3-1R (XbaI) to generate PCR fusion products encoding the complete RmCBE ORF flanked by the 
                    <italic toggle="yes">Eco</italic>RI and 
                    <italic toggle="yes">Xba</italic>I restriction sites for expression cloning. The E1+E2+E3 PCR product was phosphorylated and ligated into the pSMART-HC Kan cloning vector (Lucigen) and used to transform chemically competent 
                    <italic toggle="yes">E. coli</italic>. Plasmid DNA from 2 independent clones was subjected to Sanger sequencing on both DNA strands, confirming a perfect match to the CVSA RmCBE reference sequence (
                    <italic toggle="yes">de novo</italic> genome assembly manuscript under review) and designated pSMART-HC_Kan+RmCBE. The CVSA RmCBE was submitted to GenBank under accession OR124739.</p>
                <table-wrap id="T1" orientation="portrait" position="anchor">
                    <label>Table 1. </label>
                    <caption>
                        <title>Oligonucleotides used in this study.</title>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="left" colspan="1" rowspan="1" valign="top">Primer name</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Sequence (5'-3')</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Rm_CBE_E1-1F(EcoRI)</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">GAATTCATGGCGGTGAAAGCAGCTGTGCTG</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Rm_CBE_E1-1R</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CTGTGGGCATGCAGTTCGCGTGGA</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Rm_CBE_E2-1F</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">ATAGAGATGCAACTGGTCATCATGAAC</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Rm_CBE_E2-1R</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CCATTTTCGCTGAAGCTTCCCAGCATC</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Rm_CBE_E3-1F</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">GCGTCCCGAGCTGCCCAGCAAGCAGAAG</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Rm_CBE_E3-1R(XbaI)</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">TCTAGAGCGAAGAGTGACTTCCAGCGCTCGCATTG</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Rm_CBE-2F(EcoRI)</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">GAATTCGTCATGGCGGTGAAAGCAGCTGTGCTG</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">RmCBE_mut-1F</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">AATTCTCTTCGCGCGGCTCTATCATCATG</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">RmCBE_mut-1R</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">CTTGAGTTTCTCTGGATTGCTTCCGTC</td>
                            </tr>
                        </tbody>
                    </table>
                </table-wrap>
                <p>The complete ORF encoding RmCBE was analyzed using signalP_6.0 (
                    <ext-link ext-link-type="uri" xlink:href="https://services.healthtech.dtu.dk/services/SignalP-6.0/">https://services.healthtech.dtu.dk/services/SignalP-6.0/</ext-link>). Subsequently, the primer pair Rm_CBE-2F (EcoRI) and Rm_CBE_E3-1R (XbaI) was used to amplify the mature RmCBE (excluding the predicted signal peptide) encoding sequence from the pSMART-HC Kan vector, which contains the verified full-length ORF encoding sequence. The resulting PCR product was phosphorylated, cloned, and inserted into pSMART-HC Kan. After verification by Sanger sequencing, the construct was designated pSMART-HC_Kan+RmCBE-sigP.</p>
                <p>Site-directed mutagenesis was performed using the phosphorylated primer pair RmCBE_mut-1F and RmCBE_mut-1R to introduce the Asp374Asn mutation in the resulting PCR product using pSMART-HC_Kan+RmCBE-sigP as a template. The PCR products were subjected to 
                    <italic toggle="yes">Dpn</italic>I treatment, followed by self-ligation and transformation of competent 
                    <italic toggle="yes">E. coli</italic>. Plasmid DNA isolated from transformants was analyzed by 
                    <italic toggle="yes">Eco</italic>RI restriction digestion to confirm the presence of the mutation. Additionally, Sanger sequencing was performed to ensure that the ORF matched the wild-type sequence, except for the site-directed mutation.</p>
            </sec>
            <sec>
                <title>Expression and purification of recombinant RmCBE (rRmCBE)</title>
                <p>DNA encoding the wild-type RmCBE complete and mature ORF sequences was subcloned using 
                    <italic toggle="yes">Eco</italic>RI and 
                    <italic toggle="yes">Xba</italic>I to release the RmCBE-encoding fragments. These fragments were then ligated into the pPIC-B and pPICZ&#x03b1;-A expression vectors to ensure in-frame fusion with the c-myc epitope and a hexa-histidine tag at the 3&#x2019;-end (Invitrogen&#x2122; EasySelect&#x2122; 
                    <italic toggle="yes">Pichia</italic> Expression Kit; Catalogue number: K174001). DNA encoding the Arg374Asn-mutated RmCBE mature ORF sequence was digested with 
                    <italic toggle="yes">Eco</italic>RI and 
                    <italic toggle="yes">Xba</italic>I, resulting in the release of two fragments: a 519 bp fragment flanked by 
                    <italic toggle="yes">Eco</italic>RI and 
                    <italic toggle="yes">Xba</italic>I on the 5&#x2019; and 3&#x2019; ends, respectively, and a 1065 bp fragment flanked by 
                    <italic toggle="yes">Eco</italic>RI on both ends. The 519 bp fragment was ligated into 
                    <italic toggle="yes">Eco</italic>RI- and 
                    <italic toggle="yes">Xba</italic>I-linearized pPICZ&#x03b1;-A, and the resulting plasmid was digested with 
                    <italic toggle="yes">Eco</italic>RI, dephosphorylated and used as an acceptor vector for the 1065 bp fragment. Ligation mixtures were used to transform competent 
                    <italic toggle="yes">E. coli</italic> for subsequent plasmid DNA preparation. Restriction analysis was performed to verify cloning, and the expression construct was subjected to Sanger sequence analysis. Approximately 1 &#x00b5;g of each correct expression construct (pPICZ&#x03b1;-A+RmCBE/pPICZ-B+RmCBE/pPICZB+RmCBE-sigP/pPICZ&#x03b1;-A+RmCBE-sigP/pPICZ&#x03b1;-A+RmCBE-sigP_MUT) was linearized using 
                    <italic toggle="yes">Sac</italic>I prior to transformation. Approximately 500 ng of the resulting linear expression cassettes were then used to transform electrocompetent 
                    <italic toggle="yes">P. pastoris</italic> wild-type cells (X33) by electroporation following a condensed protocol
                    <sup>
                        <xref ref-type="bibr" rid="ref-9">9</xref>
                    </sup>. Transformed cells were subsequently plated onto YPD media supplemented with zeocin (100 &#x00b5;g/ml final concentration).</p>
                <p>The procedures described in the EasySelect&#x2122; Pichia Expression Kit manual were used to assess the transformants. The transformants were streaked onto fresh YPD plates supplemented with zeocin and subjected to PCR screening to confirm the integration of the expression cassette at the intended locus. Transformants with correctly integrated expression cassettes were subjected to small-scale expression studies using 25 ml of BMGY medium for biomass generation, followed by induction in 25 ml of BMMY medium for 96 hours. Absolute methanol was added every 24 hours to a final concentration of 0.5% (v/v). After the cultures were centrifuged (3000 
                    <italic toggle="yes">rcf</italic> for 5 min at 25&#x00b0;C), the cells and supernatants were separated and frozen at -80&#x00b0;C.</p>
                <p>The supernatants (representing 13 &#x00b5;l of crude supernatant) were analyzed on Invitrogen&#x2122; Bolt&#x2122; Bis-Tris Plus Mini Protein Gels, 4&#x2013;12%, 1.0 mm, WedgeWell&#x2122; format (Thermo Fisher Scientific; Catalogue number: NW04125BOX)  using Invitrogen&#x2122; Bolt&#x2122; MES SDS Running Buffer (Thermo Fisher Scientific; Catalogue number: B0002) and were Coomassie-stained with 25 ml SimplyBlue
                    <sup>TM</sup> Safestain (Thermo Fisher Scientific; Catalogue number: LC6065). The cells were treated under mildly alkaline conditions
                    <sup>
                        <xref ref-type="bibr" rid="ref-10">10</xref>
                    </sup>, and 3 &#x00b5;l of cell lysate was loaded for each transformant and analyzed via SDS&#x2012;PAGE as indicated above.</p>
                <p>Culture supernatants (7.5 ml) were subjected to immobilized metal affinity chromatography (IMAC) using 1 ml Thermo Scientific&#x2122; HisPur&#x2122; Ni-NTA Resin slurry and the batchwise method as per the manufacturer&#x2019;s recommendations under native conditions (Thermo Fisher Scientific; Catalogue number: 88221). The different fractions were analyzed via SDS&#x2012;PAGE, and the protein concentrations were determined using the Pierce&#x2122; BCA Protein Assay Kit (Thermo Fisher Scientific; Catalogue number: 23227).</p>
                <p>Known volumes (10 &#x00b5;l) of purified RmCBE protein, culture supernatants, and BSA standard dilutions were subjected to SDS&#x2012;PAGE analysis as indicated above. The gel images were captured with a Samsung S23 smartphone camera and analyzed with ImageJ (
                    <ext-link ext-link-type="uri" xlink:href="https://imagej.net/ij/">https://imagej.net/ij/</ext-link>) according to the one-dimensional electrophoretic gel analysis workflow. The areas under the peaks were quantified using the BCA-quantified purified rRmCBE WT and MUT proteins. These quantities were then used to calculate the volumetric productivity of the RmCBE-expressing 
                    <italic toggle="yes">P. pastoris</italic> transformants.</p>
            </sec>
            <sec>
                <title>Characterization of recombinant RmCBE</title>
                <p>Crude supernatants were diluted 10-, 100-, and 1000-fold with 50 mM Tris-HCl (pH 7.4). Recombinant protein activity assays were performed using 
                    <italic toggle="yes">p</italic>-nitrophenyl acetate (Sigma-Aldrich; Catalogue number: N8130) as a substrate, according to basic protocol 1
                    <sup>
                        <xref ref-type="bibr" rid="ref-11">11</xref>
                    </sup>. The 100-fold dilution exhibited linearity over the 5-minute monitoring of the product. Supernatants from both RmCBE-expressing and control strains (transformed with an empty plasmid) were subjected to 100-fold dilution, with a buffer-only control included to account for chemical hydrolysis. The reactions were performed in a final volume of 500 &#x00b5;l at 37&#x00b0;C for 5 min, and A
                    <sub>405</sub> readings were recorded every 7 seconds to monitor the formation of the 
                    <italic toggle="yes">p</italic>-nitrophenol product using a Jenway 7205 spectrophotometer. All hydrolytic reactions were performed in triplicate. One-way ANOVA was performed using the triplicate endpoint absorbance readings obtained during the assay, followed by a post hoc Tukey HSD test.</p>
                <p>The complete &#x03b1;-factor:RmCBE-sigP_WT/MUT:c-myc_6xHis peptide sequence was submitted to SWISS-MODEL (
                    <ext-link ext-link-type="uri" xlink:href="https://swissmodel.expasy.org/">https://swissmodel.expasy.org/</ext-link>), and the best fit template (AlphaFold DB Q9U6M8_RHIMP representing the 
                    <italic toggle="yes">R. microplus</italic> CBE; 97.71 protein identity) was selected. The resulting model was visualized and annotated in Yasara View
                    <sup>
                        <xref ref-type="bibr" rid="ref-12">12</xref>
                    </sup> to indicate the Asp374Asn position and the catalytic triad members of the active site. Both the WT and MUT models were superimposed to check for structural variation.</p>
            </sec>
        </sec>
        <sec sec-type="results | discussion">
            <title>Results and discussion</title>
            <sec>
                <title>Cloning and sequencing of RmCBE</title>
                <p>The amplicon-fused ORF DNA sequence encoding the CVSA RmCBE was identical to the RmCBE sequence obtained from the genome sequence (manuscript currently under review) and showed &#x2265;97.7% protein identity to the 
                    <italic toggle="yes">R. microp</italic>lus CBE-deduced peptide sequences in GenBank (
                    <xref ref-type="table" rid="T2">Table 2</xref>).</p>
                <table-wrap id="T2" orientation="portrait" position="anchor">
                    <label>Table 2. </label>
                    <caption>
                        <title>Deduced  amino  acid  identity  between  the  CVSA  RmCBE  and  RmCBE  sequences available in GenBank.</title>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th colspan="1" rowspan="1"/>
                                <th align="left" colspan="1" rowspan="1" valign="top">AAF00497</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">XP_037272683</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">AOA32871</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">ALD51318</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">ALD51320</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">ALD51319</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">CVSA RmCBE</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">AAF00497</td>
                                <td colspan="1" rowspan="1" style="background-color:#000000"/>
                                <td align="right" colspan="1" rowspan="1" valign="top">99.8</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">96.6</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">96.6</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">96.4</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">95.8</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">97.9</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">XP_037272683</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">99.8</td>
                                <td colspan="1" rowspan="1" style="background-color:#000000"/>
                                <td align="right" colspan="1" rowspan="1" valign="top">96.4</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">96.4</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">96.2</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">95.6</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">97.7</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">AOA32871</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">96.6</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">96.4</td>
                                <td colspan="1" rowspan="1" style="background-color:#000000"/>
                                <td align="right" colspan="1" rowspan="1" valign="top">99.6</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">99.4</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">98.9</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">98.7</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">ALD51318</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">96.6</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">96.4</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">99.6</td>
                                <td colspan="1" rowspan="1" style="background-color:#000000"/>
                                <td align="right" colspan="1" rowspan="1" valign="top">99.4</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">98.9</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">98.7</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">ALD51320</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">96.4</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">96.2</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">99.4</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">99.4</td>
                                <td colspan="1" rowspan="1" style="background-color:#000000"/>
                                <td align="right" colspan="1" rowspan="1" valign="top">99</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">98.5</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">ALD51319</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">95.8</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">95.6</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">98.9</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">98.9</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">99</td>
                                <td colspan="1" rowspan="1" style="background-color:#000000"/>
                                <td align="right" colspan="1" rowspan="1" valign="top">97.9</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">CVSA RmCBE</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">97.9</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">97.7</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">98.7</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">98.7</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">98.5</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">97.9</td>
                                <td colspan="1" rowspan="1" style="background-color:#000000"/>
                            </tr>
                        </tbody>
                    </table>
                </table-wrap>
            </sec>
            <sec>
                <title>Expression and purification of rRmCBE</title>
                <p>Signal peptide identification using SignalP_6.0 revealed a putative signal peptide encoded by residues 1 to 21 (
                    <xref ref-type="fig" rid="f1">Figure 1</xref>). Primers were designed to utilize the native signal peptide (pPICZ-B) or remove the native signal peptide and fuse residue 21 to the &#x03b1;-factor signal peptide in the pPICZ&#x03b1;-A vector.</p>
                <fig fig-type="figure" id="f1" orientation="portrait" position="float">
                    <label>Figure 1. </label>
                    <caption>
                        <title>SignalP_6.0 signal peptide prediction for the deduced protein sequence encoded by the CVSA RmCBE ORF.</title>
                    </caption>
                    <graphic orientation="portrait" position="float" xlink:href="https://gatesopenresearch-files.f1000.com/manuscripts/17609/eb464755-270e-48ea-8b14-feb6615db96b_figure1.gif"/>
                </fig>
                <p>All CVSA RmCBE-encoding genes and derivatives were cloned and inserted into pPICZ vectors for methanol-induced expression in 
                    <italic toggle="yes">P. pastoris</italic> (
                    <xref ref-type="fig" rid="f2">Figure 2</xref>). The 
                    <italic toggle="yes">Sac</italic>I linearized vectors were used to transform wild-type 
                    <italic toggle="yes">P. pastoris</italic> (X33) via genomic integration at the 
                    <italic toggle="yes">AOX1</italic> locus, which was confirmed by PCR (data not shown).</p>
                <fig fig-type="figure" id="f2" orientation="portrait" position="float">
                    <label>Figure 2. </label>
                    <caption>
                        <title>pPICZ&#x03b1;-A vector containing the CVSA RmCBE-sigP_MUT gene under the control of the 
                            <italic toggle="yes">AOX1</italic> promoter.</title>
                    </caption>
                    <graphic orientation="portrait" position="float" xlink:href="https://gatesopenresearch-files.f1000.com/manuscripts/17609/eb464755-270e-48ea-8b14-feb6615db96b_figure2.gif"/>
                </fig>
                <p>Multiple transformants obtained from each construct (6 randomly selected) were subjected to small-scale protein expression studies with biomass cultivation in phosphate-buffered BMGY medium for 24 hours followed by induction with 0.5% (v/v) methanol every 24 hours for 96 hours in phosphate-buffered BMMY medium. Supernatant and crude cell lysates were evaluated using Coomassie-stained SDS&#x2012;PAGE to detect the presence of the expected rRmCBE product. No distinct extracellularly expressed protein bands of the expected size were observed for the pPICZ-B+RmCBE or pPICZ&#x03b1;-A+RmCBE transformants subjected to small-scale protein expression with methanol induction for 96 hours after biomass generation (data not shown). The intracellular accumulation of proteins was also assessed, and no difference in the SDS&#x2012;PAGE protein profiles was detected compared to those of the empty plasmid control transformant (data not shown).</p>
                <p>Analysis of the supernatant from transformants devoid of the native signal peptide and fused in frame with the &#x03b1;-factor signal peptide revealed the presence of an approximately 70 kDa protein band in the supernatants of transformants harboring the pPICZ&#x03b1;-A+RmCBE-sigP vector cassette integrated into the genome (
                    <xref ref-type="fig" rid="f3">Figure 3</xref>). The theoretical expected size of the recombinant protein containing the &#x03b1;-factor signal peptide fused to RmCBE and the c-myc_6xHis tag was 70.9 kDa, whereas the recombinant protein with the processed &#x03b1;-factor signal peptide should have a theoretical molecular weight of 61.4 kDa.</p>
                <fig fig-type="figure" id="f3" orientation="portrait" position="float">
                    <label>Figure 3. </label>
                    <caption>
                        <title>Coomassie-stained SDS&#x2012;PAGE of supernatants obtained from transformants with an expression cassette for an in-house protein (lanes 1 and 2), &#x03b1;-factor:RmCBE devoid of the native signal peptide fusion (lanes 4&#x2013;6) and the GS115 control isolate (secreting a 67 kDa recombinant albumin) supplied with the Pichia expression kit (lane 7).</title>
                        <p>The PageRuler Plus approximate sizes are also indicated.</p>
                    </caption>
                    <graphic orientation="portrait" position="float" xlink:href="https://gatesopenresearch-files.f1000.com/manuscripts/17609/eb464755-270e-48ea-8b14-feb6615db96b_figure3.gif"/>
                </fig>
                <p>The resulting supernatant exhibiting the approximately 70 kDa protein band was subjected to immobilized metal affinity chromatography (IMAC) using Ni-NTA under native conditions via a batchwise approach. SDS&#x2012;PAGE analysis of the different fractions collected during IMAC revealed efficient binding of the approximately 70 kDa protein from the supernatant (comparing the supernatant to the unbound fraction) and elution of a distinct band of approximately 70 kDa, with most of the protein eluting during the first elution fraction (
                    <xref ref-type="fig" rid="f4">Figure 4</xref>).</p>
                <fig fig-type="figure" id="f4" orientation="portrait" position="float">
                    <label>Figure 4. </label>
                    <caption>
                        <title>Coomassie-stained SDS&#x2012;PAGE of IMAC fractions obtained during the purification of the supernatant from the RmCBE-sigP-producing transformants.</title>
                    </caption>
                    <graphic orientation="portrait" position="float" xlink:href="https://gatesopenresearch-files.f1000.com/manuscripts/17609/eb464755-270e-48ea-8b14-feb6615db96b_figure4.gif"/>
                </fig>
                <p>IMAC purification under native conditions confirmed that the 6xHis tag was accessible to interact with the Ni-NTA resin, and the observed size revealed that the recombinant RmCBE (rRmCBE) still contained an &#x03b1;-factor secretion signal (approx. 9.5 kDa) fused to the RmCBE-sigP-encoding peptide and c-myc_6xHis tag (61.4 kDa).</p>
            </sec>
            <sec>
                <title>Characterization of recombinant RmCBE</title>
                <p>Supernatants (diluted 100-fold) from two isolates secreting the &#x03b1;-factor RmCBE-sigP_WT/MUT:c-myc-6xHis protein, along with two control isolates containing empty plasmids, were subjected to CBE activity assessment using 
                    <italic toggle="yes">p</italic>-nitrophenyl acetate as a substrate. Hydrolytic product formation of 
                    <italic toggle="yes">p</italic>-nitrophenolate was monitored spectrophotometrically at 405 nm every 7 seconds for 5 minutes (
                    <xref ref-type="fig" rid="f5">Figure 5</xref>).</p>
                <fig fig-type="figure" id="f5" orientation="portrait" position="float">
                    <label>Figure 5. </label>
                    <caption>
                        <title>Spectrophotometric detection of 
                            <italic toggle="yes">p</italic>-nitrophenolate over time using a 100-fold dilution of culture supernatants.</title>
                        <p>Buffer-only controls were used as reaction blanks prior to data generation to account for chemical hydrolysis.</p>
                    </caption>
                    <graphic orientation="portrait" position="float" xlink:href="https://gatesopenresearch-files.f1000.com/manuscripts/17609/eb464755-270e-48ea-8b14-feb6615db96b_figure5.gif"/>
                </fig>
                <p>Compared with those of the empty vector controls, the culture supernatants derived from the RmCBE-harboring transformants showed at least a 4.8-fold increase in 
                    <italic toggle="yes">p</italic>-nitrophenolate formation. The RmCBE_WT_1 transformant exhibited a &gt;1.5-fold increase in activity compared to the RmCBE_WT_2, RmCBE_MUT_1, and MUT_2 transformants, most likely due to increased cassette copy number integration into the genome. End-point analysis indicated that all the rRMCBE-expressing transformants produced significantly more product (p&lt;0.01) than the transformants containing empty expression cassettes. Specifically, the RmCBE_WT_1 transformant produced significantly more product (p&lt;0.01) than the other RmCBE transformants. There was no significant difference in end-point product formation detected between the supernatants derived from the RmCBE_WT_2, RmCBE_MUT_1, and RmCBE_MUT_2 transformants.</p>
                <p>The specific activity of the WT and MUT proteins purified by IMAC could not be determined using the 
                    <italic toggle="yes">p</italic>-nitrophenyl acetate substrate due to the presence of high levels of imidazole (250 mM) in the elution buffer, which causes chemical hydrolysis of the substrate to 
                    <italic toggle="yes">p</italic>-nitrophenolate (Bender and Turnquest, 1956). However, the IMAC-purified samples were quantified using the BCA assay. Equal volumes of purified CVSA RmCBE WT and MUT proteins (10 &#x00b5;l each) were loaded alongside 10 &#x00b5;l of BSA protein (162.5, 325, and 650 ng per lane), as well as 10 &#x00b5;l of crude supernatant analyzed in the hydrolysis reaction (
                    <xref ref-type="fig" rid="f5">Figure 5</xref>). The resulting gel image was quantified using ImageJ, and the signals of the purified RmCBE were used to convert the 70 kDa bands in the supernatant signals to protein quantities (
                    <xref ref-type="fig" rid="f6">Figure 6</xref>). Known BSA controls were used as internal controls to assess the accuracy of the conversion factor. The conversion of 162.5 ng of BSA signal to protein was measured at 100.04% of the theoretical quantity loaded (
                    <xref ref-type="table" rid="T3">Table 3</xref>).</p>
                <fig fig-type="figure" id="f6" orientation="portrait" position="float">
                    <label>Figure 6. </label>
                    <caption>
                        <title>A Coomassie-stained SDS&#x2012;PAGE gel showing 6.5 &#x00b5;l of crude supernatant from the WT (lanes 1 and 2) and MUT (lanes 5 and 6) transformants, with unknown quantities, alongside WT (lane 3) and MUT (lane 7) purified proteins of known quantities.</title>
                        <p>BSA, which was loaded in known quantities, was included as a control signal for image analysis and quantification purposes.</p>
                    </caption>
                    <graphic orientation="portrait" position="float" xlink:href="https://gatesopenresearch-files.f1000.com/manuscripts/17609/eb464755-270e-48ea-8b14-feb6615db96b_figure6.gif"/>
                </fig>
                <table-wrap id="T3" orientation="portrait" position="anchor">
                    <label>Table 3. </label>
                    <caption>
                        <title>ImageJ quantification and resulting calculations based on quantified data.</title>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="center" colspan="1" rowspan="1" valign="top">Sample</th>
                                <th align="center" colspan="1" rowspan="1" valign="top">ImageJ protein quantity (ng)</th>
                                <th align="center" colspan="1" rowspan="1" valign="top">BCA measured protein quantity (ng)</th>
                                <th align="center" colspan="1" rowspan="1" valign="top">ImageJ quantity:BCA quantity</th>
                                <th align="center" colspan="1" rowspan="1" valign="top">Specific activity (&#x00b5;mol product formed/min/mg protein)</th>
                                <th align="center" colspan="1" rowspan="1" valign="top">Shake flask rRmCBE production (mg/L)</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">rRmCBE_WT_1</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">34.60</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">ND</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">NA</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">8.303</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">5.32</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">rRmCBE_WT_2</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">24.21</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">ND</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">NA</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">7.679</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">3.72</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">rRmCBE_WT_1 Elution</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">62.86</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">59.54</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">1.06</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">NA</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">NA</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">rRmCBE_MUT_1</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">17.18</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">ND</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">NA</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">9.837</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">2.64</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">rRmCBE_MUT_2</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">20.26</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">ND</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">NA</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">8.340</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">3.12</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">rRmCBE_MUT_1 Elution</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">65.27</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">69.14</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">0.94</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">NA</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">NA</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">162.5 ng BSA</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">162.57</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">162.5</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">1.00</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">NA</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">NA</td>
                            </tr>
                        </tbody>
                    </table>
                </table-wrap>
                <p>ImageJ quantification of the 70 kDa protein bands (
                    <xref ref-type="table" rid="T3">Table 3</xref>) in the supernatants indicated that the amount of RmCBE_WT_1 was 1.43-fold greater than that of RmCBE_WT_2, which is in concordance with the increased hydrolytic activity observed (
                    <xref ref-type="fig" rid="f5">Figure 5</xref>). Specific activity determinations toward the universal CBE substrate 
                    <italic toggle="yes">p</italic>-nitrophenyl acetate, based on the ImageJ protein quantities and the hydrolytic activities, indicated no apparent difference between the WT and MUT versions of the rRmCBE proteins assessed. The presence of the mutation (
                    <xref ref-type="fig" rid="f7">Figure 7A</xref>; blue residue) in the cap structure, which forms part of the solvent accessible tunnel toward the active site (catalytic triad residues in yellow) (
                    <xref ref-type="fig" rid="f7">Figure 7 A and B</xref>), might alter substrate binding pockets specific to SP-derived substrates.</p>
                <fig fig-type="figure" id="f7" orientation="portrait" position="float">
                    <label>Figure 7. </label>
                    <caption>
                        <p>Superimposed 3D protein models of the CVSA RmCBE WT and MUT proteins with the Asp374Asn mutation (Asp, red; Asn, blue) and the active site catalytic triad members (yellow) displayed as balls and sticks (
                            <bold>A</bold>). The solvent-accessible surface overlay indicating the tunnel toward the active site (red box; 
                            <bold>B</bold>) CBE substrate and hydrolytic products used in this study (
                            <italic toggle="yes">p</italic>-nitrophenyl acetate) and a typical insecticidal pyrethroid (
                            <italic toggle="yes">trans</italic>-permethrin) (
                            <bold>C</bold>; taken from Ross and Borazjani, 2007).</p>
                    </caption>
                    <graphic orientation="portrait" position="float" xlink:href="https://gatesopenresearch-files.f1000.com/manuscripts/17609/eb464755-270e-48ea-8b14-feb6615db96b_figure7.gif"/>
                </fig>
                <p>The smaller chemical structure of 
                    <italic toggle="yes">p</italic>-nitrophenyl acetate (relative to SP derivatives; 
                    <xref ref-type="fig" rid="f7">Figure 7C</xref>) is unlikely to be affected by the Asp374Asn mutation, which is located close to the conserved putative substrate binding pockets on a relatively distant &#x03b1;-helix. The effect of the mutation will only become evident with the assessment of SP derivatives currently in commercial use.</p>
                <p>The specific activity of the supernatant rRmCBE toward 
                    <italic toggle="yes">p</italic>-nitrophenyl acetate (
                    <xref ref-type="table" rid="T3">Table 3</xref>) is comparable to that of commercially available His-tagged recombinant human carboxylesterase 1 derived from mammalian cell culture (6 &#x00b5;mol/min/mg; 
                    <ext-link ext-link-type="uri" xlink:href="https://www.rndsystems.com/products/recombinant-human-carboxylesterase-1-ces1-protein-cf_4920-ce">https://www.rndsystems.com/products/recombinant-human-carboxylesterase-1-ces1-protein-cf_4920-ce</ext-link>).</p>
                <p>Quantification of the rRmCBE protein in the supernatant allowed the calculation of the volumetric productivity of the secreted rRmCBE by the recombinant host cultures evaluated, which ranged between 2.64 and 5.32 mg/L under unoptimized shake flask culture conditions (
                    <xref ref-type="table" rid="T3">Table 3</xref>).</p>
            </sec>
        </sec>
        <sec sec-type="conclusions">
            <title>Conclusion</title>
            <p>The CVSA RmCBE WT and Asp374Asn mutant-encoding genes were successfully expressed and secreted extracellularly from 
                <italic toggle="yes">P. pastoris</italic>. The recombinant proteins were approximately 70 kDa in size, suggesting that the heterologous &#x03b1;-factor secretion signal was not processed and formed part of the secreted recombinant protein. Activity determination using 
                <italic toggle="yes">p</italic>-nitrophenyl acetate revealed that the culture supernatants of the transformants harboring the RmCBE WT and MUT expression cassettes exhibited activity toward the substrate and resulted in 
                <italic toggle="yes">p</italic>-nitrophenolate product formation. No significant difference in specific activity was observed between the WT and MUT recombinant enzymes present in the supernatant. The RmCBE WT and MUT recombinant enzymes were purified using single-step affinity chromatography, resulting in relatively pure proteins. Further characterization of the purified protein toward the SP-derived substrates was not possible due to time constraints. Future work could use both wild-type and mutant purified rRmCBE proteins to characterize their effects on the most frequently used synthetic pyrethroid acaricides, thereby elucidating the effect of the Asp374Asn mutation and whether it is indeed responsible for the observed resistant phenotype.</p>
        </sec>
        <sec>
            <title>Ethics and consent</title>
            <p>Ethical approval and consent were not required</p>
        </sec>
        <sec sec-type="materials">
            <title>Materials &amp; correspondence</title>
            <p>All correspondence and requests can be sent to ML.</p>
        </sec>
    </body>
    <back>
        <sec sec-type="data-availability">
            <title>Data availability</title>
            <p>The CVSA 
                <italic toggle="yes">R. microplus</italic> CBE encoding gene sequence is available at: GenBank. Accession OR124739. 
                <ext-link ext-link-type="uri" xlink:href="https://www.ncbi.nlm.nih.gov/nuccore/OR124739.1/">https://www.ncbi.nlm.nih.gov/nuccore/OR124739.1/</ext-link> (Labuschagne, M., 2023).</p>
        </sec>
        <sec>
            <title>Author contributions</title>
            <p>ML conceived, designed the study, performed the experiments, analysed the data, and drafted the manuscript.</p>
        </sec>
        <ack>
            <title>Acknowledgements</title>
            <p>I would like to acknowledge Christina Meiring from Clinglobal for the critical reading of the manuscript.</p>
        </ack>
        <ref-list>
            <ref id="ref-1">
                <label>1</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Lew-Tabor</surname>
                            <given-names>AE</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Rodriguez Valle</surname>
                            <given-names>M</given-names>
                        </name>
</person-group>:
                    <article-title>A review of reverse vaccinology approaches for the development of vaccines against ticks and tick borne diseases.</article-title>
                    <source>

                        <italic toggle="yes">Ticks Tick Borne Dis.</italic>
</source>
                    <year>2016</year>;<volume>7</volume>(<issue>4</issue>):<fpage>573</fpage>&#x2013;<lpage>85</lpage>.
                    <pub-id pub-id-type="pmid">26723274</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.ttbdis.2015.12.012</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-2">
                <label>2</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Obaid</surname>
                            <given-names>MK</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Islam</surname>
                            <given-names>N</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Alouffi</surname>
                            <given-names>A</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Acaricides resistance in ticks: selection, diagnosis, mechanisms, and mitigation.</article-title>
                    <source>

                        <italic toggle="yes">Front Cell Infect Microbiol.</italic>
</source>
                    <year>2022</year>;<volume>12</volume>:
                    <elocation-id>941831</elocation-id>.
                    <pub-id pub-id-type="pmid">35873149</pub-id>
                    <pub-id pub-id-type="doi">10.3389/fcimb.2022.941831</pub-id>
                    <pub-id pub-id-type="pmcid">9299439</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-3">
                <label>3</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Davies</surname>
                            <given-names>TGE</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Field</surname>
                            <given-names>LM</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Usherwood</surname>
                            <given-names>PNR</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>DDT, pyrethrins, pyrethroids and insect sodium channels.</article-title>
                    <source>

                        <italic toggle="yes">IUBMB Life.</italic>
</source>
                    <year>2007</year>;<volume>59</volume>(<issue>3</issue>):<fpage>151</fpage>&#x2013;<lpage>62</lpage>.
                    <pub-id pub-id-type="pmid">17487686</pub-id>
                    <pub-id pub-id-type="doi">10.1080/15216540701352042</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-4">
                <label>4</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Stone</surname>
                            <given-names>NE</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Olafson</surname>
                            <given-names>PU</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Davey</surname>
                            <given-names>RB</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Multiple mutations in the 
                        <italic toggle="yes">para</italic>-sodium channel gene are associated with pyrethroid resistance in 
                        <italic toggle="yes">Rhipicephalus microplus</italic> from the United States and Mexico.</article-title>
                    <source>

                        <italic toggle="yes">Parasit Vectors.</italic>
</source>
                    <year>2014</year>;<volume>7</volume>: 456.
                    <pub-id pub-id-type="pmid">25266983</pub-id>
                    <pub-id pub-id-type="doi">10.1186/s13071-014-0456-z</pub-id>
                    <pub-id pub-id-type="pmcid">4189684</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-5">
                <label>5</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Coss&#x00ed;o-Bay&#x00fa;gar</surname>
                            <given-names>R</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Miranda-Miranda</surname>
                            <given-names>E</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Mart&#x00ed;nez-Iba&#x00f1;ez</surname>
                            <given-names>F</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Physiological evidence that three known mutations in the para-sodium channel gene confer cypermethrin knockdown resistance in 
                        <italic toggle="yes">Rhipicephalus microplus</italic>.</article-title>
                    <source>

                        <italic toggle="yes">Parasit Vectors.</italic>
</source>
                    <year>2020</year>;<volume>13</volume>(<issue>1</issue>): 370.
                    <pub-id pub-id-type="pmid">32698905</pub-id>
                    <pub-id pub-id-type="doi">10.1186/s13071-020-04227-7</pub-id>
                    <pub-id pub-id-type="pmcid">7376655</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-6">
                <label>6</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Jamroz</surname>
                            <given-names>RC</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Guerrero</surname>
                            <given-names>FD</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Pruett</surname>
                            <given-names>JH</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Molecular and biochemical survey of acaricide resistance mechanisms in larvae from Mexican strains of the southern cattle tick, boophilus microplus.</article-title>
                    <source>

                        <italic toggle="yes">J Insect Physiol.</italic>
</source>
                    <year>2000</year>;<volume>46</volume>(<issue>5</issue>):<fpage>685</fpage>&#x2013;<lpage>95</lpage>.
                    <pub-id pub-id-type="pmid">10742517</pub-id>
                    <pub-id pub-id-type="doi">10.1016/s0022-1910(99)00157-2</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-7">
                <label>7</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Guerrero</surname>
                            <given-names>FD</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Nene</surname>
                            <given-names>VM</given-names>
                        </name>
</person-group>:
                    <article-title>Gene structure and expression of a pyrethroid-metabolizing esterase, CzEst9, from a pyrethroid resistant Mexican population of Rhipicephalus (Boophilus) microplus (Acari: Ixodidae).</article-title>
                    <source>

                        <italic toggle="yes">J Med Entomol.</italic>
</source>
                    <year>2008</year>;<volume>45</volume>(<issue>4</issue>):<fpage>677</fpage>&#x2013;<lpage>85</lpage>.
                    <pub-id pub-id-type="pmid">18714867</pub-id>
                    <pub-id pub-id-type="doi">10.1603/0022-2585(2008)45[677:gsaeoa]2.0.co;2</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-8">
                <label>8</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Karbalaei</surname>
                            <given-names>M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Rezaee</surname>
                            <given-names>SA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Farsiani</surname>
                            <given-names>H</given-names>
                        </name>
</person-group>:
                    <article-title>
                        <italic toggle="yes">Pichia pastoris</italic>: a highly successful expression system for optimal synthesis of heterologous proteins.</article-title>
                    <source>

                        <italic toggle="yes">J Cell Physiol.</italic>
</source>
                    <year>2020</year>;<volume>235</volume>(<issue>9</issue>):<fpage>5867</fpage>&#x2013;<lpage>81</lpage>.
                    <pub-id pub-id-type="pmid">32057111</pub-id>
                    <pub-id pub-id-type="doi">10.1002/jcp.29583</pub-id>
                    <pub-id pub-id-type="pmcid">7228273</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-9">
                <label>9</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Lin-Cereghino</surname>
                            <given-names>J</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Wong</surname>
                            <given-names>WW</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Xiong</surname>
                            <given-names>S</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Condensed protocol for competent cell preparation and transformation of the methylotrophic yeast 
                        <italic toggle="yes">Pichia pastoris</italic>.</article-title>
                    <source>

                        <italic toggle="yes">Biotechniques.</italic>
</source>
                    <year>2005</year>;<volume>38</volume>(<issue>1</issue>):<fpage>44, 46, 48</fpage>.
                    <pub-id pub-id-type="pmid">15679083</pub-id>
                    <pub-id pub-id-type="doi">10.2144/05381BM04</pub-id>
                    <pub-id pub-id-type="pmcid">2504082</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-10">
                <label>10</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Kushnirov</surname>
                            <given-names>VV</given-names>
                        </name>
</person-group>:
                    <article-title>Rapid and reliable protein extraction from yeast.</article-title>
                    <source>

                        <italic toggle="yes">Yeast.</italic>
</source>
                    <year>2000</year>;<volume>16</volume>(<issue>9</issue>):<fpage>857</fpage>&#x2013;<lpage>60</lpage>.
                    <pub-id pub-id-type="pmid">10861908</pub-id>
                    <pub-id pub-id-type="doi">10.1002/1097-0061(20000630)16:9&lt;857::AID-YEA561&gt;3.0.CO;2-B</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-11">
                <label>11</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ross</surname>
                            <given-names>MK</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Borazjani</surname>
                            <given-names>A</given-names>
                        </name>
</person-group>:
                    <article-title>Enzymatic activity of human carboxylesterases.</article-title>
                    <source>

                        <italic toggle="yes">Curr Protoc Toxicol.</italic>
</source>
                    <year>2007</year>;<volume>33</volume>(<issue>1</issue>): Chapter 4:Unit 4.24.
                    <pub-id pub-id-type="pmid">23045146</pub-id>
                    <pub-id pub-id-type="doi">10.1002/0471140856.tx0424s33</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-12">
                <label>12</label>
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Land</surname>
                            <given-names>H</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Humble</surname>
                            <given-names>MS</given-names>
                        </name>
</person-group>:
                    <article-title>YASARA: a tool to obtain structural guidance in biocatalytic investigations.</article-title>
                    <source>

                        <italic toggle="yes">Methods Mol Biol.</italic>
</source>
                    <year>2018</year>;<volume>1685</volume>:<fpage>43</fpage>&#x2013;<lpage>67</lpage>.
                    <pub-id pub-id-type="pmid">29086303</pub-id>
                    <pub-id pub-id-type="doi">10.1007/978-1-4939-7366-8_4</pub-id>
                </mixed-citation>
            </ref>
        </ref-list>
    </back>
    <sub-article article-type="reviewer-report" id="report39103">
        <front-stub>
            <article-id pub-id-type="doi">10.21956/gatesopenres.17609.r39103</article-id>
            <title-group>
                <article-title>Reviewer response for version 1</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Hammid</surname>
                        <given-names>Anam</given-names>
                    </name>
                    <xref ref-type="aff" rid="r39103a1">1</xref>
                    <role>Referee</role>
                    <uri content-type="orcid">https://orcid.org/0000-0003-1939-7047</uri>
                </contrib>
                <aff id="r39103a1">
                    <label>1</label>University of Eastern Finland,, Kuopio, Finland</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>9</day>
                <month>1</month>
                <year>2025</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2025 Hammid A</copyright-statement>
                <copyright-year>2025</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport39103" related-article-type="peer-reviewed-article" xlink:href="10.12688/gatesopenres.16245.1"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>This manuscript presents the cloning, expression, and partial characterization of both the wild-type and a mutant (Asp374Asn) Rhipicephalus microplus carboxylesterase (RmCBE). The study investigates this enzyme because the Asp374Asn mutation in RmCBE might be linked to increased resistance to synthetic pyrethroid (SP) acaricides, which are crucial for controlling tick populations in the cattle industry.</p>
            <p> </p>
            <p> The researchers cloned the RmCBE gene from a susceptible R. microplus isolate and introduced the Asp374Asn mutation using site-directed mutagenesis. They successfully expressed both the wild-type and mutant RmCBE proteins in&#x00a0;
                <italic>Pichia pastoris</italic>&#x00a0;and purified them through immobilized metal affinity chromatography. The enzymatic activity of the recombinant proteins was then assessed using p-nitrophenyl acetate as a substrate. Both the wild-type and mutant enzymes could hydrolyze this substrate, with no significant difference in their specific activities.</p>
            <p> </p>
            <p> The authors suggest that the lack of difference in specific activity between the wild-type and mutant enzymes may be due to the small size of the p-nitrophenyl acetate substrate. They recommend future research to focus on characterizing the enzymes' activity towards SP-derived substrates, which are more likely to be affected by the Asp374Asn mutation.</p>
            <p> </p>
            <p> Overall, this manuscript is a well-executed study. The authors provide evidence that the Asp374Asn mutation does not affect the ability of RmCBE to hydrolyze p-nitrophenyl acetate. However, they cannot demonstrate that the mutation makes it a better or more active enzyme. Further studies are needed to determine whether this mutation affects the enzyme's ability to hydrolyze SPs.</p>
            <p> </p>
            <p> Suggestions:</p>
            <p> 1. It is suggested to improve the conclusion and discussion section to highlight the significance of the study. This conclusion is not enough to justify the study. The more detailed conclusion and future work required in the subject should be highlighted.</p>
            <p> </p>
            <p> 2. Please clarify Figure 7 and add more details on protein models. What is the source to design the structure?&#x00a0;</p>
            <p> </p>
            <p> 3. In addition to enzymatic activity studies with p-nitrophenyl acetate substrate, additional inhibition studies would have been included in the study to validate the specific activity of the enzymes.</p>
            <p>Is the work clearly and accurately presented and does it cite the current literature?</p>
            <p>Yes</p>
            <p>If applicable, is the statistical analysis and its interpretation appropriate?</p>
            <p>Not applicable</p>
            <p>Are all the source data underlying the results available to ensure full reproducibility?</p>
            <p>Yes</p>
            <p>Is the study design appropriate and is the work technically sound?</p>
            <p>Yes</p>
            <p>Are the conclusions drawn adequately supported by the results?</p>
            <p>Yes</p>
            <p>Are sufficient details of methods and analysis provided to allow replication by others?</p>
            <p>Yes</p>
            <p>Reviewer Expertise:</p>
            <p>Molecular Biology, Protein chemistry, Proteomics</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.</p>
        </body>
    </sub-article>
    <sub-article article-type="reviewer-report" id="report39102">
        <front-stub>
            <article-id pub-id-type="doi">10.21956/gatesopenres.17609.r39102</article-id>
            <title-group>
                <article-title>Reviewer response for version 1</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Soliman</surname>
                        <given-names>Nadia A.</given-names>
                    </name>
                    <xref ref-type="aff" rid="r39102a1">1</xref>
                    <role>Referee</role>
                </contrib>
                <aff id="r39102a1">
                    <label>1</label>Universities and Research Institutes Zone, Alexandria, Egypt</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>7</day>
                <month>1</month>
                <year>2025</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2025 Soliman NA</copyright-statement>
                <copyright-year>2025</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport39102" related-article-type="peer-reviewed-article" xlink:href="10.12688/gatesopenres.16245.1"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>
                <bold>Reviewer Report</bold>
            </p>
            <p> I have reviewed the manuscript entitled "Cloning, Recombinant Expression, and Characterization of a 
                <italic>Rhipicephalus microplus</italic> Carboxylesterase" (Code: F1KR00CDE Gates-VER17609-R).</p>
            <p> 
                <bold>Summary of the Work:</bold> This study investigates the 
                <italic>Rhipicephalus microplus</italic> carboxylesterase (CBE), a protein involved in the hydrolysis of synthetic pyrethroids (SPs), which are linked to increased resistance to SP-based acaricides due to a non-synonymous mutation (Asp374Asn). The authors cloned the CBE gene and functionally expressed it in 
                <italic>Pichia pastoris</italic> following the removal of the native signal peptide. Site-directed mutagenesis introduced the Asp374Asn substitution. Both wild-type and mutant CBEs were successfully expressed, characterized, and purified using affinity chromatography under native conditions. The findings offer valuable insights into the production of recombinant tick-derived CBE proteins and will aid further research into SP resistance in ticks.</p>
            <p> 
                <bold>General Comments:</bold> The manuscript presents valuable data; however, several areas could be improved to enhance clarity and readability. Specifically, the authors should consider revising and restructuring certain sentences to more clearly outline the sequence of experimental steps and avoid redundancy. This would improve the overall flow and comprehension of the text.</p>
            <p> 
                <bold>Specific Comments:</bold> 
                <list list-type="order">
                    <list-item>
                        <p>
                            <bold>Clarity and Structure:</bold> The authors are encouraged to revise complex sentences to improve the logical flow and readability of the manuscript. This will help readers follow the experimental process more easily and reduce unnecessary repetition.</p>
                    </list-item>
                    <list-item>
                        <p>
                            <bold>Imidazole Interference:</bold> The issue of imidazole interference in activity measurements is not sufficiently addressed. Imidazole in the elution buffer can affect substrate hydrolysis and skew the results. I recommend that the authors discuss strategies for removing imidazole from the samples before activity measurements. One potential solution could be the use of a gel filtration column, such as PD-10, or performing dialysis to remove imidazole from the protein samples. These methods would help mitigate the interference and enhance the accuracy of the activity assays.</p>
                    </list-item>
                </list>
            </p>
            <p>Is the work clearly and accurately presented and does it cite the current literature?</p>
            <p>Yes</p>
            <p>If applicable, is the statistical analysis and its interpretation appropriate?</p>
            <p>Not applicable</p>
            <p>Are all the source data underlying the results available to ensure full reproducibility?</p>
            <p>Yes</p>
            <p>Is the study design appropriate and is the work technically sound?</p>
            <p>Yes</p>
            <p>Are the conclusions drawn adequately supported by the results?</p>
            <p>Partly</p>
            <p>Are sufficient details of methods and analysis provided to allow replication by others?</p>
            <p>Yes</p>
            <p>Reviewer Expertise:</p>
            <p>Microbiologist and molecular biology biotechnology</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.</p>
        </body>
    </sub-article>
    <sub-article article-type="reviewer-report" id="report39096">
        <front-stub>
            <article-id pub-id-type="doi">10.21956/gatesopenres.17609.r39096</article-id>
            <title-group>
                <article-title>Reviewer response for version 1</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Sun</surname>
                        <given-names>Shengwei</given-names>
                    </name>
                    <xref ref-type="aff" rid="r39096a1">1</xref>
                    <role>Referee</role>
                </contrib>
                <aff id="r39096a1">
                    <label>1</label>KTH Royal Institute of Technology, Stockholm, Sweden</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>26</day>
                <month>12</month>
                <year>2024</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2024 Sun S</copyright-statement>
                <copyright-year>2024</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport39096" related-article-type="peer-reviewed-article" xlink:href="10.12688/gatesopenres.16245.1"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>reject</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>In the present study, the author solved the cloning, expression, and characterization of an animal carboxylesterase. Both wide-type and the mutant Asp374Asn were cloned, expressed and purified using column method. The manuscript looks interesting, but a lot of issues need to be addressed. Therefore, I would not recommend the indexing of the current manuscript. Specific comments are shown below.</p>
            <p> 1. In the method section, the author used a lot of molecular biology methods to do the cloning. In fact, this can be done by genetic synthesis in a efficient way. And a diagram of the cloning procedure is good for readers to understand the process. Moreover, some key technical parameters should be described in the method part. For example, how to purify the proteins is unclear.&#x00a0;</p>
            <p> 2. For protein expression and purification, it is good to test the effect of different signal peptide on the protein expression extracellularly. The codon optimization is needed to be done before the cloning.&#x00a0;</p>
            <p> 3. The p-nitrophenyl acetate is generally used for the characterization of the esterase activity. It does not make sense to use it to understand the resistance of SP-based acaricides in this study. The substrate should be a specific synthetic pyrethroid used for determining the differences between the wide-type CBE and the mutant Asp374Asn.&#x00a0;&#x00a0;</p>
            <p> 4. No statistical analysis was done in the study. This makes the data unreliable.&#x00a0;</p>
            <p> 5. More discussion and published papers should be provided in the main text. Then it looks like a SCI paper.</p>
            <p>Is the work clearly and accurately presented and does it cite the current literature?</p>
            <p>No</p>
            <p>If applicable, is the statistical analysis and its interpretation appropriate?</p>
            <p>No</p>
            <p>Are all the source data underlying the results available to ensure full reproducibility?</p>
            <p>Partly</p>
            <p>Is the study design appropriate and is the work technically sound?</p>
            <p>No</p>
            <p>Are the conclusions drawn adequately supported by the results?</p>
            <p>No</p>
            <p>Are sufficient details of methods and analysis provided to allow replication by others?</p>
            <p>Partly</p>
            <p>Reviewer Expertise:</p>
            <p>Enzyme, protein engineering, applied microbiology, environmental microbiology</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to state that I do not consider it to be of an acceptable scientific standard, for reasons outlined above.</p>
        </body>
        <sub-article article-type="response" id="comment3762-39096">
            <front-stub>
                <contrib-group>
                    <contrib contrib-type="author">
                        <name>
                            <surname>Labuschagne</surname>
                            <given-names>Michel</given-names>
                        </name>
                        <aff>Research Innovation, Clinglobal, Bloemfontein, Free State, South Africa</aff>
                    </contrib>
                </contrib-group>
                <author-notes>
                    <fn fn-type="conflict">
                        <p>
                            <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                    </fn>
                </author-notes>
                <pub-date pub-type="epub">
                    <day>27</day>
                    <month>12</month>
                    <year>2024</year>
                </pub-date>
            </front-stub>
            <body>
                <p>Response to reviewer:</p>
                <p> The work presented in this report was conducted as part of a larger study and the aim of this report was to express and secrete active 
                    <italic>R. microplus</italic> CBE using recombinant methods. The CBE was of interest due to historic data indicating that the Asp374Asn mutation was most likely responsible for the synthetic pyrethroid resistant phenotype observed. Due to time constraints we decided to publish this report on the cloning and functional expression of the 
                    <italic>R. microplus</italic> CBE genes (WT and MUT) in Gates Open Research to contribute towards the data available to the tick research community. This report will allow other researchers, interested in continuing to study the impact of the mutation, to recombinantly express and secrete active WT and MUT versions of the 
                    <italic>R. microplus</italic> CBE for further characterization.&#x00a0;</p>
                <p> Addressing the specific comments by the reviewer:</p>
                <p> 1. The aim of the study was the functional expression of RmCBE. Not to perform high level expression of RmCBE for industrial application. Even though gene synthesis using codon optimization is an easy and efficient way to obtain the target gene in many geographies, we do not have access to such a local service and importation of synthetic constructs has a time-value that could not be afforded due to the time constrains regarding the project. The codon adaptation index (CAI) of the 
                    <italic>R. microplus</italic> sequence was 0.59, supporting the cloning methodology used in this work and allowed the amplification and fusion of the 3 exons in a single working day. The methodology is clearly described in the text.</p>
                <p> The reviewer also indicates that technical parameters, eg. protein purification is unclear. The methods section indicate clearly that we used 7.5 ml supernatant with using 1 ml ThermoScientific&#x2122; HisPur&#x2122; Ni-NTA Resin slurry and the batch-wise method as per the manufacturer&#x2019;s recommendations under native</p>
                <p> conditions (Thermo Fisher Scientific; Catalogue number: 88221). The batch-wise method provided by the manufacturer clearly describe each step and the wash and elution volumes are expressed as resin bed volumes.</p>
                <p> 2. Comment 2 refers to signal peptides and some codon optimization. Again, the aim was to perform functional secretion of recombinant CBE protein. Evaluation of several different signal peptides (other than the highly efficient alpha-factor) coupled with codon optimization should be used if you want to increase protein production yields if this was the aim of the study and this could be combined with high density cultivation of the recombinant protein production host using a bioreactor.</p>
                <p> 3. The use of p-nitrophenyl acetate as substrate was so indicate the presence of esterase activity and confirm that the secreted protein resulted in a increased hydrolytic activity towards p-nitrophenyl acetate. The paper clearly states in the conclusion that "Further characterization of the purified protein toward the SP-derived substrates was not possible due to time constraints. Future work could use both</p>
                <p> wild-type and mutant purified rRmCBE proteins to characterize their effects on the most frequently used synthetic pyrethroid acaricides, thereby elucidating the effect of the Asp374Asn mutation and whether it is indeed responsible for the observed resistant phenotype" Performing SP-based activity assays was originally planned, but sourcing the specific analytical columns and substrates was not permitted due to time constrains - please keep in mind that all of the specialty components (standards and columns) are not readily available within South Africa.&#x00a0;</p>
                <p> 4. The reviewer indicated that no statistical analysis was performed. The methods section indicate clearly that a one-way ANOVA was performed on the absorbance values, followed by a post hoc Tukey HSD test. We reported significance in the results section.</p>
                <p> 5. The reviewer indicates more discussion of published papers should be provided in the main text. We included and discussed all published data on the 
                    <italic>R. microplus</italic> CBE.</p>
            </body>
        </sub-article>
    </sub-article>
    <sub-article article-type="reviewer-report" id="report38136">
        <front-stub>
            <article-id pub-id-type="doi">10.21956/gatesopenres.17609.r38136</article-id>
            <title-group>
                <article-title>Reviewer response for version 1</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Reynaud</surname>
                        <given-names>Enrique</given-names>
                    </name>
                    <xref ref-type="aff" rid="r38136a1">1</xref>
                    <role>Referee</role>
                    <uri content-type="orcid">https://orcid.org/0000-0001-7972-2230</uri>
                </contrib>
                <aff id="r38136a1">
                    <label>1</label>Universidad Nacional Aut&#x00f3;noma de M&#x00e9;xico, Cuernavaca, Mexico</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>10</day>
                <month>10</month>
                <year>2024</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2024 Reynaud E</copyright-statement>
                <copyright-year>2024</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport38136" related-article-type="peer-reviewed-article" xlink:href="10.12688/gatesopenres.16245.1"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>This manuscript describes the cloning, expression, and partial characterization of the wild-type and a mutant (Asp374Asn) 
                <italic>Rhipicephalus microplus</italic> carboxylesterase (RmCBE). The rationale for studying this enzyme, is that the Asp374Asn mutation in RmCBE may be associated with increased resistance to synthetic pyrethroid (SP) acaricides. This is a significant finding because SPs are a major class of acaricides, and resistance to these chemicals is a serious threat to the cattle industry.</p>
            <p> The authors cloned the RmCBE gene from a susceptible R. microplus isolate. They then used site-directed mutagenesis to introduce the Asp374Asn mutation into the gene. They successfully expressed both the wild-type and mutant RmCBE proteins in Pichia pastoris and purified the proteins using inmobilized metal affinity chromatography. Then the enzymatic activity of the recombinant proteins was characterized using p-nitrophenyl acetate as a substrate. They found that both the wild-type and mutant enzymes were able to hydrolyze this substrate, but there was no significant difference in their specific activities.</p>
            <p> The authors propose that the lack of difference in specific activity between the wild-type and mutant enzymes may be due to the small size of the p-nitrophenyl acetate substrate. They also&#x00a0; suggest that future work should focus on characterizing the activity of the enzymes toward SP-derived substrates, which are more likely to be affected by the Asp374Asn mutation.</p>
            <p> Overall, this manuscript is a well-executed study. The authors provide evidence that the Asp374Asn mutation does not affect the ability of RmCBE to hydrolyze p-nitrophenyl acetate, however they cannot demonstrate that the mutation makes it a better or more active enzyme. Further studies are needed to determine whether this mutation affects the enzyme's ability to hydrolyze SPs.</p>
            <p> </p>
            <p> Minor suggestions:</p>
            <p> </p>
            <p> The authors should include a more detailed discussion of the limitations of their study, such as the effect of the size of the substrate on the enzyme activity.</p>
            <p> The authors should consider including a figure showing the alignment of the CVSA RmCBE protein sequence with other RmCBE sequences from GenBank. This would help to illustrate the high degree of conservation among these proteins.</p>
            <p> While a 3D model is presented, the authors do not comment on what (if any) existing structural data was used to create their model (e.g. AlphaFold). Since the authors propose that the Asp374Asn mutation, located in the cap structure of the enzyme, might alter substrate binding pockets specific to SP-derived substrates, providing details on the model generation would strengthen the study.</p>
            <p> </p>
            <p> </p>
            <p>Is the work clearly and accurately presented and does it cite the current literature?</p>
            <p>Yes</p>
            <p>If applicable, is the statistical analysis and its interpretation appropriate?</p>
            <p>Not applicable</p>
            <p>Are all the source data underlying the results available to ensure full reproducibility?</p>
            <p>Yes</p>
            <p>Is the study design appropriate and is the work technically sound?</p>
            <p>Yes</p>
            <p>Are the conclusions drawn adequately supported by the results?</p>
            <p>Yes</p>
            <p>Are sufficient details of methods and analysis provided to allow replication by others?</p>
            <p>Yes</p>
            <p>Reviewer Expertise:</p>
            <p>Arthropod neurobiology, developmental neurobiology, acarology, physiology, molecuolar biology</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.</p>
        </body>
    </sub-article>
</article>
