<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.2 20190208//EN" "http://jats.nlm.nih.gov/publishing/1.2/JATS-journalpublishing1.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" article-type="research-article" dtd-version="1.2" xml:lang="en">
    <front>
        <journal-meta>
            <journal-id journal-id-type="pmc">Gates Open Res</journal-id>
            <journal-title-group>
                <journal-title>Gates Open Research</journal-title>
            </journal-title-group>
            <issn pub-type="epub">2572-4754</issn>
            <publisher>
                <publisher-name>F1000 Research Limited</publisher-name>
                <publisher-loc>London, UK</publisher-loc>
            </publisher>
        </journal-meta>
        <article-meta>
            <article-id pub-id-type="doi">10.12688/gatesopenres.13347.2</article-id>
            <article-categories>
                <subj-group subj-group-type="heading">
                    <subject>Research Article</subject>
                </subj-group>
                <subj-group>
                    <subject>Articles</subject>
                </subj-group>
            </article-categories>
            <title-group>
                <article-title>Environmental factors influence the local establishment of 
                    <italic>Wolbachia</italic> in 
                    <italic>Aedes aegypti</italic> mosquitoes in two small communities in central Vietnam</article-title>
                <fn-group content-type="pub-status">
                    <fn>
                        <p>[version 2; peer review: 2 approved]</p>
                    </fn>
                </fn-group>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Hien</surname>
                        <given-names>Nguyen T.</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Project Administration</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Anh</surname>
                        <given-names>Dang D.</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Project Administration</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Le</surname>
                        <given-names>Nguyen H.</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Project Administration</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Yen</surname>
                        <given-names>Nguyen T.</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Project Administration</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Phong</surname>
                        <given-names>Tran V.</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Project Administration</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Nam</surname>
                        <given-names>Vu S.</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Project Administration</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Duong</surname>
                        <given-names>Tran N.</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Project Administration</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Nguyen</surname>
                        <given-names>Nguyen B.</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Project Administration</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Huong</surname>
                        <given-names>Duong T.T.</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Hung</surname>
                        <given-names>Luu Q.</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Trinh</surname>
                        <given-names>Chau N.T.</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Hoang</surname>
                        <given-names>Nguyen V.</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <xref ref-type="aff" rid="a1">1</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Mai</surname>
                        <given-names>Vien Q.</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Project Administration</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <xref ref-type="aff" rid="a2">2</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Nghia</surname>
                        <given-names>Le T.</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Project Administration</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <xref ref-type="aff" rid="a2">2</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Dong</surname>
                        <given-names>Nguyen T.</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Project Administration</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <xref ref-type="aff" rid="a2">2</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Tho</surname>
                        <given-names>Le H.</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Project Administration</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <xref ref-type="aff" rid="a3">3</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Kutcher</surname>
                        <given-names>Simon</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Project Administration</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <xref ref-type="aff" rid="a4">4</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Hurst</surname>
                        <given-names>Tim P.</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Project Administration</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <xref ref-type="aff" rid="a4">4</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Montgomery</surname>
                        <given-names>Jacqui L.</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Project Administration</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <xref ref-type="aff" rid="a4">4</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Woolfit</surname>
                        <given-names>Megan</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Project Administration</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <xref ref-type="aff" rid="a4">4</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Rances</surname>
                        <given-names>Edwige</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Project Administration</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <xref ref-type="aff" rid="a4">4</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Kyrylos</surname>
                        <given-names>Peter</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Formal Analysis</role>
                    <role content-type="http://credit.niso.org/">Validation</role>
                    <role content-type="http://credit.niso.org/">Visualization</role>
                    <xref ref-type="aff" rid="a4">4</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>L. Anders</surname>
                        <given-names>Katherine</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Formal Analysis</role>
                    <role content-type="http://credit.niso.org/">Validation</role>
                    <role content-type="http://credit.niso.org/">Visualization</role>
                    <uri content-type="orcid">https://orcid.org/0000-0003-0485-5826</uri>
                    <xref ref-type="aff" rid="a4">4</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Nguyen</surname>
                        <given-names>Le</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Data Curation</role>
                    <role content-type="http://credit.niso.org/">Formal Analysis</role>
                    <role content-type="http://credit.niso.org/">Validation</role>
                    <role content-type="http://credit.niso.org/">Visualization</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <xref ref-type="aff" rid="a4">4</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Brown-Kenyon</surname>
                        <given-names>Jack</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Data Curation</role>
                    <role content-type="http://credit.niso.org/">Formal Analysis</role>
                    <role content-type="http://credit.niso.org/">Validation</role>
                    <role content-type="http://credit.niso.org/">Visualization</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <xref ref-type="aff" rid="a4">4</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Caird</surname>
                        <given-names>Angela</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <xref ref-type="aff" rid="a4">4</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>McLean</surname>
                        <given-names>Breeanna J.</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <uri content-type="orcid">https://orcid.org/0000-0002-8584-9614</uri>
                    <xref ref-type="aff" rid="a4">4</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Iturbe-Ormaetxe</surname>
                        <given-names>Inaki</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <xref ref-type="aff" rid="a4">4</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>Ritchie</surname>
                        <given-names>Scott A.</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <xref ref-type="aff" rid="a4">4</xref>
                </contrib>
                <contrib contrib-type="author" corresp="no">
                    <name>
                        <surname>O'Neill</surname>
                        <given-names>Scott L.</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Conceptualization</role>
                    <role content-type="http://credit.niso.org/">Formal Analysis</role>
                    <role content-type="http://credit.niso.org/">Funding Acquisition</role>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Original Draft Preparation</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <uri content-type="orcid">https://orcid.org/0000-0002-4131-3615</uri>
                    <xref ref-type="aff" rid="a4">4</xref>
                </contrib>
                <contrib contrib-type="author" corresp="yes">
                    <name>
                        <surname>Ryan</surname>
                        <given-names>Peter A.</given-names>
                    </name>
                    <role content-type="http://credit.niso.org/">Conceptualization</role>
                    <role content-type="http://credit.niso.org/">Formal Analysis</role>
                    <role content-type="http://credit.niso.org/">Investigation</role>
                    <role content-type="http://credit.niso.org/">Methodology</role>
                    <role content-type="http://credit.niso.org/">Supervision</role>
                    <role content-type="http://credit.niso.org/">Validation</role>
                    <role content-type="http://credit.niso.org/">Visualization</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Original Draft Preparation</role>
                    <role content-type="http://credit.niso.org/">Writing &#x2013; Review &amp; Editing</role>
                    <uri content-type="orcid">https://orcid.org/0000-0003-0674-4441</uri>
                    <xref ref-type="corresp" rid="c1">a</xref>
                    <xref ref-type="aff" rid="a4">4</xref>
                </contrib>
                <aff id="a1">
                    <label>1</label>National Institute of Hygiene and Epidemiology, Hanoi, Vietnam</aff>
                <aff id="a2">
                    <label>2</label>Institute Pasteur, Nha Trang, Vietnam</aff>
                <aff id="a3">
                    <label>3</label>Khanh Hoa Health Department, Nha Trang, Vietnam</aff>
                <aff id="a4">
                    <label>4</label>World Mosquito Program, Institute of Vector-Borne Disease, Monash University, Clayton, Victoria, 3800, Australia</aff>
            </contrib-group>
            <author-notes>
                <corresp id="c1">
                    <label>a</label>
                    <email xlink:href="mailto:peter.ryan@worldmosquito.org">peter.ryan@worldmosquito.org</email>
                </corresp>
                <fn fn-type="conflict">
                    <p>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>7</day>
                <month>4</month>
                <year>2022</year>
            </pub-date>
            <pub-date pub-type="collection">
                <year>2021</year>
            </pub-date>
            <volume>5</volume>
            <elocation-id>147</elocation-id>
            <history>
                <date date-type="accepted">
                    <day>20</day>
                    <month>1</month>
                    <year>2022</year>
                </date>
            </history>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2022 Hien NT et al.</copyright-statement>
                <copyright-year>2022</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access article distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <self-uri content-type="pdf" xlink:href="https://gatesopenresearch.org/articles/5-147/pdf"/>
            <abstract>
                <p>
                    <bold>Background:</bold> The 
                    <italic toggle="yes">w</italic>Mel strain of 
                    <italic toggle="yes">Wolbachia</italic> has been successfully introduced into 
                    <italic toggle="yes">Aedes aegypti</italic> mosquitoes and subsequently shown to reduce transmission of dengue and other pathogens, under both laboratory and field conditions. Here we describe the entomological outcomes of 
                    <italic toggle="yes">w</italic>Mel 
                    <italic toggle="yes">Wolbachia</italic> mosquito releases in two small communities in Nha Trang City in central Vietnam.</p>
                <p>
                    <bold>Methods:</bold> The 
                    <italic toggle="yes">w</italic>Mel strain of 
                    <italic toggle="yes">Wolbachia</italic> was backcrossed into local 
                    <italic toggle="yes">Aedes aegypti</italic> genotype and mosquito releases were undertaken by community members or by staff. Field monitoring was undertaken to track 
                    <italic toggle="yes">Wolbachia</italic> establishment in local 
                    <italic toggle="yes">Ae. aegypti</italic> mosquito populations. Ecological studies were undertaken to assess relationships between environmental factors and the spatial and temporal variability in 
                    <italic toggle="yes">Wolbachia</italic> infection prevalence in mosquitoes. </p>
                <p>
                    <bold>Results:</bold> Releases of 
                    <italic toggle="yes">w</italic>Mel 
                    <italic toggle="yes">Wolbachia Ae. aegypti</italic> mosquitoes in two small communities in Nha Trang City resulted in the initial establishment of 
                    <italic toggle="yes">Wolbachia</italic> in the local 
                    <italic toggle="yes">Ae. aegypti</italic> mosquito populations, followed by seasonal fluctuations in 
                    <italic toggle="yes">Wolbachia</italic> prevalence. There was significant small-scale spatial heterogeneity in 
                    <italic toggle="yes">Wolbachia</italic> infection prevalence in the Tri Nguyen Village site, resulting in the loss of 
                    <italic toggle="yes">w</italic>Mel 
                    <italic toggle="yes">Wolbachia</italic> infection in mosquitoes in north and center areas, despite 
                    <italic toggle="yes">Wolbachia</italic> prevalence remaining high in mosquitoes in the south area. In the second site, Vinh Luong Ward, 
                    <italic toggle="yes">Wolbachia</italic> has persisted at a high level in mosquitoes throughout this site despite similar seasonal fluctuations in 
                    <italic toggle="yes">w</italic>Mel 
                    <italic toggle="yes">Wolbachia</italic> prevalence.</p>
                <p>
                    <bold>Conclusion:</bold> Seasonal variation in 
                    <italic toggle="yes">Wolbachia</italic> infection prevalence in mosquitoes was associated with elevated temperature conditions, and was possibly due to imperfect maternal transmission of 
                    <italic toggle="yes">Wolbachia</italic>. Heterogeneity in 
                    <italic toggle="yes">Wolbachia</italic> infection prevalence was found throughout one site, and indicates additional factors may influence 
                    <italic toggle="yes">Wolbachia</italic> establishment.</p>
            </abstract>
            <kwd-group kwd-group-type="author">
                <kwd>Dengue</kwd>
                <kwd>World Mosquito Program</kwd>
                <kwd>Wolbachia</kwd>
                <kwd>Aedes aegypti</kwd>
                <kwd>mosquito release</kwd>
            </kwd-group>
            <funding-group>
                <award-group id="fund-1">
                    <funding-source>Macquarie Group Foundation</funding-source>
                </award-group>
                <award-group id="fund-2">
                    <funding-source>Wellcome Trust</funding-source>
                    <award-id>102591</award-id>
                </award-group>
                <award-group id="fund-3" xlink:href="http://dx.doi.org/10.13039/100000009">
                    <funding-source>Foundation for the National Institutes of Health</funding-source>
                </award-group>
                <award-group id="fund-4" xlink:href="http://dx.doi.org/10.13039/100000865">
                    <funding-source>Gates Foundation</funding-source>
                    <award-id>OPP1180815</award-id>
                    <award-id>OPP1153619</award-id>
                </award-group>
                <funding-statement>This work was supported by the Gates Foundation [OPP1180815], the Vector-Based Control of Transmission: Discovery Research (VCTR) program of the Grand Challenges in Global Health initiative [OPP1153619] managed by the Foundation for the National Institutes of Health, Wellcome Trust [102591] and the Macquarie Group Foundation.</funding-statement>
                <funding-statement>
                    <italic>The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.</italic>
                </funding-statement>
            </funding-group>
        </article-meta>
        <notes>
            <sec sec-type="version-changes">
                <label>Revised</label>
                <title>Amendments from Version 1</title>
                <p>This new version includes a revised Figure 5 that now shows the mean numbers of 
                    <italic>Wolbachia</italic> mosquitoes released per house per week (consistent with Figure 4). Weekly rainfall data has been added to Figures 6 and 7 and the 
                    <italic>Wolbachia</italic> infection curves have been amended to show that sampling was interrupted between July 2019 and March 2011 in Tri Nguyen, and between January and October 2020 in Vinh Luong. This version also provides additional data on the 
                    <italic>Wolbachia</italic> density in mosquitoes collected in BGS traps (new Figure 12) and statistical analyses showing a significant negative association between 
                    <italic>Wolbachia</italic> density and lagged mean daily temperatures in houses (new Table 5). Additional analyses of 
                    <italic>Ae. aegypti</italic> abundance data from BGS traps indicated that there was no clear association between seasonal or spatial patterns in mosquito abundance and 
                    <italic>Wolbachia</italic> establishment (new Figure 13 and statistical analyses). Further text has been added to the Results and Discussion to recognize that water temperatures were not directly measured in field containers and therefore the seasonal loss of 
                    <italic>w</italic>Mel infection cannot be directly attributed to high water temperatures in these larval habitats. We cited previous work highlighting the important of water storage tanks and jars to the bionomics of 
                    <italic>Ae. aegypti</italic> in Tri Nguyen and indicated that future monitoring should be undertaken to investigate the relationship between seasonal water temperatures in field containers and 
                    <italic>w</italic>Mel infection levels in 
                    <italic>Ae. aegypti</italic>. Several minor corrections were made to the text, including removal of redundant sections of text, a correction to the primers and probe used for 
                    <italic>Wolbachia</italic> screening of samples from Tri Nguyen, and we inserted links to the additional underlying data for 
                    <italic>Wolbachia</italic> density (Figure 12) and 
                    <italic>Ae. aegypti</italic> abundance (Figure 13).</p>
            </sec>
        </notes>
    </front>
    <body>
        <sec sec-type="intro">
            <title>Introduction</title>
            <p>
                <italic toggle="yes">Aedes aegypti</italic> mosquitoes containing the 
                <italic toggle="yes">w</italic>Mel 
                <italic toggle="yes">Wolbachia</italic> strain have been shown to have a reduced ability to transmit a range of viruses including dengue, Zika, chikungunya, yellow fever and Mayaro viruses (
                <xref ref-type="bibr" rid="ref-46">Ryan 
                    <italic toggle="yes">et al.</italic>, 2020</xref>). Field trials involving releases of 
                <italic toggle="yes">w</italic>Mel 
                <italic toggle="yes">Wolbachia</italic> infected 
                <italic toggle="yes">Ae. aegypti</italic> mosquitoes have shown that 
                <italic toggle="yes">Wolbachia</italic> can be deployed and established in local mosquito populations (
                <xref ref-type="bibr" rid="ref-7">Garcia 
                    <italic toggle="yes">et al.</italic>, 2019</xref>; 
                <xref ref-type="bibr" rid="ref-8">Gesto 
                    <italic toggle="yes">et al.</italic>, 2021</xref>; 
                <xref ref-type="bibr" rid="ref-9">Hoffmann 
                    <italic toggle="yes">et al.</italic>, 2011</xref>; 
                <xref ref-type="bibr" rid="ref-10">Hoffmann 
                    <italic toggle="yes">et al.</italic>, 2014</xref>; 
                <xref ref-type="bibr" rid="ref-11">Indriani 
                    <italic toggle="yes">et al.</italic>, 2020</xref>; 
                <xref ref-type="bibr" rid="ref-19">O'Neill 
                    <italic toggle="yes">et al.</italic>, 2019</xref>; 
                <xref ref-type="bibr" rid="ref-46">Ryan 
                    <italic toggle="yes">et al.</italic>, 2020</xref>; 
                <xref ref-type="bibr" rid="ref-47">Schmidt 
                    <italic toggle="yes">et al.</italic>., 2017</xref>; 
                <xref ref-type="bibr" rid="ref-48">Tantowijoyo 
                    <italic toggle="yes">et al.</italic>, 2020</xref>; 
                <xref ref-type="bibr" rid="ref-51">Utarini 
                    <italic toggle="yes">et al.</italic>, 2021</xref>). The 
                <italic toggle="yes">w</italic>Mel 
                <italic toggle="yes">Wolbachia</italic> infection has been shown to persist in local mosquito populations (
                <xref ref-type="bibr" rid="ref-8">Gesto 
                    <italic toggle="yes">et al.</italic>, 2021</xref>; 
                <xref ref-type="bibr" rid="ref-19">O'Neill 
                    <italic toggle="yes">et al.</italic>, 2019</xref>; 
                <xref ref-type="bibr" rid="ref-46">Ryan 
                    <italic toggle="yes">et al.</italic>, 2020</xref>; 
                <xref ref-type="bibr" rid="ref-48">Tantowijoyo 
                    <italic toggle="yes">et al.</italic>, 2020</xref>; 
                <xref ref-type="bibr" rid="ref-51">Utarini 
                    <italic toggle="yes">et al.</italic>, 2021</xref>), and the viral blocking properties remain stable (
                <xref ref-type="bibr" rid="ref-1">Carrington 
                    <italic toggle="yes">et al.</italic>, 2018</xref>; 
                <xref ref-type="bibr" rid="ref-6">Frentiu 
                    <italic toggle="yes">et al.</italic>, 2014</xref>; 
                <xref ref-type="bibr" rid="ref-8">Gesto 
                    <italic toggle="yes">et al.</italic>, 2021</xref>). In areas where 
                <italic toggle="yes">w</italic>Mel 
                <italic toggle="yes">Wolbachia</italic> has been established in local mosquito populations, dengue incidence has been significantly reduced, resulting in near elimination of local dengue transmission in northern Australia (
                <xref ref-type="bibr" rid="ref-19">O'Neill 
                    <italic toggle="yes">et al.</italic>, 2019</xref>; 
                <xref ref-type="bibr" rid="ref-46">Ryan 
                    <italic toggle="yes">et al.</italic>, 2020</xref>); 73% reduction in dengue incidence in a quasi-experimental trial in Yogyakarta, Indonesia (
                <xref ref-type="bibr" rid="ref-11">Indriani 
                    <italic toggle="yes">et al.</italic>, 2020</xref>); 77.1% reduction in dengue incidence in a cluster randomized trial in Yogyakarta, Indonesia (
                <xref ref-type="bibr" rid="ref-51">Utarini 
                    <italic toggle="yes">et al.</italic>, 2021</xref>); and 69% reduction in dengue incidence, 56% reduction in chikungunya incidence, and 37% reduction in Zika incidence, in Niter&#x00f3;i, Brazil (
                <xref ref-type="bibr" rid="ref-20">Pinto 
                    <italic toggle="yes">et al.</italic>, 2021</xref>).</p>
            <p>Here we describe the entomological outcomes of 
                <italic toggle="yes">w</italic>Mel 
                <italic toggle="yes">Wolbachia</italic> mosquito releases in two small communities in Nha Trang City in central Vietnam. These releases resulted in the initial establishment of 
                <italic toggle="yes">w</italic>Mel 
                <italic toggle="yes">Wolbachia</italic> in the local 
                <italic toggle="yes">Ae. aegypti</italic> mosquito populations, followed by seasonal fluctuations in 
                <italic toggle="yes">Wolbachia</italic> infection prevalence in 
                <italic toggle="yes">Ae. aegypti</italic> mosquitoes. In the Tri Nguyen Village site we observed significant small-scale spatial heterogeneity in 
                <italic toggle="yes">Wolbachia</italic> infection prevalence, with localized losses of infection in north and central areas but high prevalence in the south area. Despite similar overall climatic conditions and seasonal fluctuations in 
                <italic toggle="yes">w</italic>Mel 
                <italic toggle="yes">Wolbachia</italic> prevalence in the second site, Vinh Luong Ward, 
                <italic toggle="yes">Wolbachia</italic> has persisted at a high level in mosquitoes throughout this site. We investigate the environmental factors that may be associated with the observed fluctuations in 
                <italic toggle="yes">Wolbachia</italic> infection prevalence in mosquitoes in these sites. 
</p>
        </sec>
        <sec sec-type="methods">
            <title>Methods</title>
            <sec>
                <title>Intervention area</title>
                <p>
                    <italic toggle="yes">Tri Nguyen village.</italic> Releases occurred in Tri Nguyen village, a fishing community located on Hon Mieu Island, Nha Trang City, in central Vietnam. The island is located 1 km from Nha Trang City, and is approximately 1.2 km
                    <sup>2</sup> (117 ha) in size. The densely populated area on Tri Nguyen village is approximately 0.22 km
                    <sup>2</sup> (22 ha) in size and is comprised of 821 households (population 3,527), located in a rough north-south pattern on the western side of the island (
                    <xref ref-type="fig" rid="f1">Figure 1</xref>, 
                    <xref ref-type="fig" rid="f2">Figure 2</xref>).</p>
                <fig fig-type="figure" id="f1" orientation="portrait" position="float">
                    <label>Figure 1. </label>
                    <caption>
                        <title>Map of Tri Nguyen village and Vinh Luong release areas in Nha Trang City, Vietnam.</title>
                    </caption>
                    <graphic orientation="portrait" position="float" xlink:href="https://gatesopenresearch-files.f1000.com/manuscripts/14782/28024d43-fd50-43c9-ad0e-5c5cf9dd8b7a_figure1.gif"/>
                </fig>
                <fig fig-type="figure" id="f2" orientation="portrait" position="float">
                    <label>Figure 2. </label>
                    <caption>
                        <title>Tri Nguyen village.</title>
                    </caption>
                    <graphic orientation="portrait" position="float" xlink:href="https://gatesopenresearch-files.f1000.com/manuscripts/14782/28024d43-fd50-43c9-ad0e-5c5cf9dd8b7a_figure2.gif"/>
                </fig>
                <p>
                    <italic toggle="yes">Vinh Luong Ward.</italic> Vinh Luong Ward is a fishing community located approximately 10 km north of the Nha Trang City center. The release area of 1.0 km
                    <sup>2</sup> was comprised of eight hamlets in the central residential area with a population of 12,143 in 2,846 households (
                    <xref ref-type="fig" rid="f1">Figure 1</xref>, 
                    <xref ref-type="fig" rid="f3">Figure 3</xref>).</p>
                <fig fig-type="figure" id="f3" orientation="portrait" position="float">
                    <label>Figure 3. </label>
                    <caption>
                        <title>Vinh Luong Ward.</title>
                    </caption>
                    <graphic orientation="portrait" position="float" xlink:href="https://gatesopenresearch-files.f1000.com/manuscripts/14782/28024d43-fd50-43c9-ad0e-5c5cf9dd8b7a_figure3.gif"/>
                </fig>
            </sec>
            <sec>
                <title>Rearing</title>
                <p>For the Tri Nguyen releases in 2014, a local 
                    <italic toggle="yes">w</italic>Mel 
                    <italic toggle="yes">Ae. aegypti</italic> line was created by mating infected virgin females from a Cairns, Australia 
                    <italic toggle="yes">w</italic>Mel-infected 
                    <italic toggle="yes">Ae. aegypti</italic> line (described in 
                    <xref ref-type="bibr" rid="ref-52">Walker 
                        <italic toggle="yes">et al.</italic>, 2011</xref>) to uninfected males from Tri Nguyen for six generations (
                    <xref ref-type="table" rid="T1">Table 1</xref>). The uninfected wild-type mosquitoes were collected as larvae or pupae from water holding containers, or as eggs from  ovitraps (
                    <xref ref-type="bibr" rid="ref-22">Ritchie, 2001</xref>), from households in Tri Nguyen village. To minimize laboratory adaptation after backcrossing, male 
                    <italic toggle="yes">Ae. aegypti</italic> from field collected 
                    <italic toggle="yes">Ae. aegypti</italic> (F1 eggs) obtained from Tri Nguyen village as described above, were introduced into the colony each generation, so that they constituted 10% of the new male population. Two colonies (release stock and back-up) were maintained in two insectaries located at the National Institute of Hygiene and Epidemiology (NIHE), Hanoi, Vietnam. Both colonies had 30 cages (30 x 30 x 30 cm), stocked at a density of around 400 females, and were bloodfed on human volunteers weekly. Volunteer blood feeders were sourced from institutional (NIHE) staff or their colleagues and were excluded if their temperature was 38&#x00b0;C or above, if they had been taking antibiotics in the last five days or if they had been experiencing a febrile illness. Volunteers provided an exposed arm or leg to a cage of mosquitoes for 10 minutes (maximum of three cages per volunteer), with each cage of mosquitoes exposed only to a single volunteer. Eggs were collected from containers lined with filter paper, with each cage producing approximately 6,000 eggs. Egg strips were removed from cages and placed onto adsorbent paper towel and stored in sealed plastic bags for three days at 27&#x00b0;C, after which time they were removed from the plastic bags and paper towel and were then dried under insectary conditions (27&#x00b0;C, 80% relative humidity) for 90&#x2013;120 minutes. Dried egg strips were then packed between sheets of filter paper and transferred to sealed plastic bags each containing a 2 x 3 cm piece of moistened filter paper to maintain moisture and prevent desiccation of the eggs. The sealed plastic bags containing the egg strips were placed into insulated containers and were shipped under ambient temperature conditions to Institute Pasteur Nha Trang (IPNT) via courier.</p>
                <table-wrap id="T1" orientation="portrait" position="anchor">
                    <label>Table 1. </label>
                    <caption>
                        <title>
                            <italic toggle="yes">w</italic>Mel 
                            <italic toggle="yes">Wolbachia Aedes aegypti</italic> release lines for Tri Nguyen and Vinh Luong sites.</title>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="left" colspan="1" rowspan="1" valign="top">Release
                                    <break/> line</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">Characteristic</th>
                                <th align="left" colspan="4" rowspan="1" valign="top">Description</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="left" colspan="1" rowspan="7" valign="top">Tri Nguyen</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Backcrossing source</td>
                                <td align="left" colspan="4" rowspan="1" valign="top">Tri Nguyen</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Backcrossing method</td>
                                <td align="left" colspan="4" rowspan="1" valign="top">Six generations of backcrossing, followed by introduction of 10% wild type males
                                    <break/> (F1) per generation</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">Wolbachia</italic> infection rate</td>
                                <td align="left" colspan="4" rowspan="1" valign="top">qPCR screening of subsample of larvae from each generation of colony material
                                    <break/> (minimum 
                                    <italic toggle="yes">Wolbachia</italic> prevalence of &gt; 97%)</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Egg hatch rate (Pre-release)</td>
                                <td align="left" colspan="4" rowspan="1" valign="top">Sample of colony eggs from n = 6 cages, hatch rate assessed for each cage
                                    <break/>Mean hatch rate 96.4% +/- 3.7% (s.d.)</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Fecundity (Release)</td>
                                <td align="left" colspan="4" rowspan="1" valign="top">Eggs from n = 50 females, fecundity and hatch rate assessed for each female
                                    <break/>52.2 +/- 12.4% (s.d.)</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Hatch rate (Release)</td>
                                <td align="left" colspan="4" rowspan="1" valign="top">72.2% +/- 12.5% (s.d.)</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Maternal transmission (Release)</td>
                                <td align="left" colspan="4" rowspan="1" valign="top">n = 50 females
                                    <break/>Mean infection rate in progeny 100.0% +/- 0.0% (sd) </td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Vinh Luong</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Backcrossing source</td>
                                <td align="left" colspan="4" rowspan="1" valign="top">Nha Trang City urban area (F1)</td>
                            </tr>
                            <tr>
                                <td colspan="1" rowspan="1"/>
                                <td align="left" colspan="1" rowspan="1" valign="top">Backcrossing Method</td>
                                <td align="left" colspan="4" rowspan="1" valign="top">Six generations of backcrossing, followed by introduction of 10&#x2013;20% wild type 
                                    <break/>males (F1) per generation</td>
                            </tr>
                            <tr>
                                <td colspan="1" rowspan="1"/>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <italic toggle="yes">Wolbachia</italic> infection rate (Pre-
                                    <break/>release and release)</td>
                                <td align="left" colspan="4" rowspan="1" valign="top">qPCR screening of 172 adult mosquitoes from each generation of colony material
                                    <break/>Average 
                                    <italic toggle="yes">Wolbachia</italic> infection rate 100% +/- 0.0% (s.d.)</td>
                            </tr>
                            <tr>
                                <td colspan="1" rowspan="1"/>
                                <td align="left" colspan="1" rowspan="1" valign="top">Fecundity (Pre-release)</td>
                                <td align="left" colspan="4" rowspan="1" valign="top">n = 50 females
                                    <break/>Mean 71.5 +/- 16.5 (sd) eggs per female</td>
                            </tr>
                            <tr>
                                <td colspan="1" rowspan="1"/>
                                <td align="left" colspan="1" rowspan="1" valign="top">Egg hatch rate (Pre-Release)</td>
                                <td align="left" colspan="4" rowspan="1" valign="top">Sample of eggs from n = 50 females, hatch rate assessed for each female
                                    <break/>Mean 78.5% +/- 22.8% (sd)</td>
                            </tr>
                            <tr>
                                <td colspan="1" rowspan="1"/>
                                <td align="left" colspan="1" rowspan="1" valign="top">Maternal transmission (Pre-release)</td>
                                <td align="left" colspan="4" rowspan="1" valign="top">n = 50 females
                                    <break/>Mean infection rate in progeny 100.0% +/- 0.0% (sd)</td>
                            </tr>
                            <tr>
                                <td colspan="1" rowspan="1"/>
                                <td align="left" colspan="1" rowspan="1" valign="top">Insecticide resistance</td>
                                <td align="left" colspan="2" rowspan="1" valign="top"> Vinh Luong Release line (Pre-release)</td>
                                <td align="left" colspan="2" rowspan="1" valign="top">Nha Trang City urban (F1)</td>
                            </tr>
                            <tr>
                                <th colspan="1" rowspan="1"/>
                                <th align="left" colspan="1" rowspan="1" valign="top">
                                    <bold>Insecticide</bold>
                                </th>
                                <th align="center" colspan="1" rowspan="1" valign="top">
                                    <bold>Mean Mortality (%)</bold>
                                </th>
                                <th align="center" colspan="1" rowspan="1" valign="top">
                                    <bold>(sd)</bold>
                                </th>
                                <th align="center" colspan="1" rowspan="1" valign="top">
                                    <bold>Mean Mortality (%)</bold>
                                </th>
                                <th align="center" colspan="1" rowspan="1" valign="top">
                                    <bold>(sd)</bold>
                                </th>
                            </tr>
                            <tr>
                                <td colspan="1" rowspan="1"/>
                                <td align="left" colspan="1" rowspan="1" valign="top">Malathion (0.8%)</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">11.0</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">(5.5)</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">4.0</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">(4.2)</td>
                            </tr>
                            <tr>
                                <td colspan="1" rowspan="1"/>
                                <td align="left" colspan="1" rowspan="1" valign="top">Malathion (5.0%)</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">100.0</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">(0)</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">99.0</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">(2.2)</td>
                            </tr>
                            <tr>
                                <td colspan="1" rowspan="1"/>
                                <td align="left" colspan="1" rowspan="1" valign="top">Bendiocarb (0.1%)</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">74.0</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">(6.5)</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">66.0</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">(6.5)</td>
                            </tr>
                            <tr>
                                <td colspan="1" rowspan="1"/>
                                <td align="left" colspan="1" rowspan="1" valign="top">Bendiocard (0.5%)</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">100.0</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">(0)</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">100.0</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">(0)</td>
                            </tr>
                            <tr>
                                <td colspan="1" rowspan="1"/>
                                <td align="left" colspan="1" rowspan="1" valign="top">Permethrin (0.25%)</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">1.0</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">(2.2)</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">8.0</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">(7.6)</td>
                            </tr>
                            <tr>
                                <td colspan="1" rowspan="1"/>
                                <td align="left" colspan="1" rowspan="1" valign="top">Permethrin (1.25%)</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">3.0</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">(2.7)</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">17.0</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">(11.0)</td>
                            </tr>
                            <tr>
                                <td colspan="1" rowspan="1"/>
                                <td align="left" colspan="1" rowspan="1" valign="top">Deltamethrin (0.03%)</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">9.0</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">(2.2)</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">18.0</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">(7.6)</td>
                            </tr>
                            <tr>
                                <td colspan="1" rowspan="1"/>
                                <td align="left" colspan="1" rowspan="1" valign="top">Deltamethrin (0.15%)</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">67.0</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">(10.4)</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">76.0</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">(9.6)</td>
                            </tr>
                        </tbody>
                    </table>
                </table-wrap>
                <p>For quality assurance of the mosquito colonies, a total of 10 adult mosquitoes were randomly sampled from cages at four to five days after blood-feeding, and were screened for DENV and CHIK by qRT-PCT (
                    <xref ref-type="bibr" rid="ref-21">Quyen 
                        <italic toggle="yes">et al.</italic>, 2018</xref>). Primer and probe sequences are as follows; pan-DENV F: AAGGACTAGAGGTTAGAGGAGACCC and R: CGTTCTGTGCCTGGAATGATG, with probe 5&#x2019;-Lc640 (or Cy5)- AACAGCATATTGACGCTGGGAGAGACCAGA- Iowablack -3&#x2019; and CHIKV F: 5&#x2019;-AAGCTYCGCGTCCTTTACCAAG3&#x2019;, R: 5&#x2019;-CCAAATTGTCCYGGTCTTCCT-3&#x2019; with probe 5&#x2019;-HEX-CCAATGTCYTCNGCCTGGACACCTT- BHQ1 -3&#x2019;. RNA underwent one freeze-thaw cycle with qRT-PCR reaction performed using the Lightcycler Multiplex RNA Virus Master kit (Roche) with the following conditions; 50 &#x00b0;C for 10 mins, 95 &#x00b0;C for 30 sec, followed by 45 cycles of 95 &#x00b0;C for 3 sec, 60 &#x00b0;C for 30 sec, 72 &#x00b0;C for 1 sec and 1 cycle of 40 &#x00b0;C for 1 sec.</p>
                <p>For 
                    <italic toggle="yes">Wolbachia</italic> screening, a random sample of larvae and adult females were tested for 
                    <italic toggle="yes">w</italic>Mel infection by Taqman qPCR each week (
                    <xref ref-type="bibr" rid="ref-4">Dar 
                        <italic toggle="yes">et al.</italic>, 2008</xref>; 
                    <xref ref-type="bibr" rid="ref-19">O&#x2019;Neill 
                        <italic toggle="yes">et al.</italic>, 2019</xref>; 
                    <xref ref-type="bibr" rid="ref-55">Yeap 
                        <italic toggle="yes">et al.</italic>, 2014</xref>), with a minimum acceptable 
                    <italic toggle="yes">Wolbachia</italic> prevalence of 97%. qPCR was undertaken using the Lightcycler 480 Probes Master (Roche) kit with cycling conditions; x1 95&#x00b0;C for 5 minutes, x45 95&#x00b0;C for 10 seconds, 60&#x00b0;C for 15 seconds, 72&#x00b0;C for 1 second with single acquisition and x1 40&#x00b0;C  for 10 seconds. 
                    <italic toggle="yes">Wolbachia</italic> was detected using either TM513 (primers F: 5&#x2019;-CAAATTGCTCTTGTCCTGTGG -3&#x2019;, R: 5&#x2019;-GGGTGTTAAGCAGAGTTACGG-3&#x2019; and probe 5&#x2019;-LC640 -TGAAATGGAAAAATTGGCGAGGTGTAGG-iowaBlack-3&#x2019;) or WSP primers (F: 5&#x2019;-CATTGGTGTTGGTGTTGGTG-3&#x2019;, R: 5&#x2019;-ACACCAGCTTTTACTTGACCAG-3&#x2019; with probe: 5&#x2019;-LC640-TCCTTTGGAACCCGCTGTGAATGA-IowaBlack-3&#x2019;) and 
                    <italic toggle="yes">Ae. aegypti</italic> rps17 reference detected with primers F: 5'-TCCGTGGTATCTCCATCAAGCT-3', R: 5'-CACTTCCGGCACGTAGTTGTC-3' and probe 5'FAM- CAGGAGGAGGAACGTGAGCGCAG-BHQ1-3). All qPCR and qRT-PCR  testing were undertaken using the LightCycler 480 Instrument II - Roche Life Science.</p>
                <p>The 
                    <italic toggle="yes">Wolbachia</italic> mosquito line was characterized in terms of key fitness traits including adult female fecundity, egg hatch rate, and 
                    <italic toggle="yes">Wolbachia</italic> maternal transmission efficiency using previously described methods (
                    <xref ref-type="bibr" rid="ref-52">Walker 
                        <italic toggle="yes">et al.</italic>, 2011</xref>; 
                    <xref ref-type="bibr" rid="ref-80">Yeap 
                        <italic toggle="yes">et al.</italic>, 2011</xref>) (
                    <xref ref-type="table" rid="T1">Table 1</xref>). Fecundity was assessed using multiple human blood feeders with a total of 50 bloodfed female mosquitoes. Females were transferred into individual 40mL tubes containing water and filter paper, for oviposition. Females were allocated seven days in oviposition tubes until they were examined for the presence or absence of eggs, at which time the eggs were counted to determine fecundity. Hatch rates of eggs were determined by transferring paper and water from oviposition tubes into trays containing 250mL of water and a small amount of larval diet as described below. Eggs were left for 48 hours to hatch before the larvae in each tray were counted. As some eggs may not have matured during the first hatch, egg papers were dried down and stored for three days before immersing a second time. The numbers of larvae from the first and second hatch were combined to determine the hatch rate of eggs. For maternal transmission assessments, 
                    <italic toggle="yes">Wolbachia</italic> infected virgin females were mated with wild-type F0 or F1 males over a 24 h period. After 24 h a human blood meal was provided and individual females that appeared fully engorged were placed into individual oviposition cups. Each cup was lined with a moistened piece of filter paper as a medium for oviposition. After 24 hrs following oviposition, the female mosquitoes were collected and stored in 70% ethanol, and the eggs were counted and then conditioned for three days, prior to hatching in water containing a small amount of larval diet as described below. After 24 hours the number of hatched larvae were recorded. Larvae were reared until they reached II-IV instar then transferred to 70% ethanol. Adult females and progeny (n=10&#x2013;20) were processed for 
                    <italic toggle="yes">Wolbachia</italic> infection using a Taqman qPCR assay as described above.</p>
                <p> Egg viability was also monitored to determine the effectiveness of egg storage and incubation methods as well as any effects of transport between the release stock colony at NIHE (Hanoi) and the rearing facility at IPNT in Nha Trang. For each egg shipment, one egg strip was randomly selected and a sample of 100 eggs were removed. Eggs were assessed visually as intact, collapsed or hatched, and were counted. Eggs were then transferred to a hatching solution containing a small amount of larval diet as described below. After 24 hours the numbers of hatched larvae were counted and the hatch rate was calculated against the number of intact eggs above.</p>
                <p>Eggs shipped from NIHE were hatched and reared in the IPNT insectary, where temperatures ranged between 26&#x2013;31&#x00b0;C. For the Tri Nguyen releases, larvae (400/bucket) were reared in 4 L buckets and fed a diet of ground Tetramin Tropical Tablets (Tetra Holding [US] Inc. Germany, Product number 16110). When approximately 90% of larvae had pupated, 30 larvae/pupae were transferred into individual plastic cups (6 cm diameter x 10 cm high). A mesh cover was placed on each cup and adults were maintained for 3&#x2013;4 days on 20% sucrose solution. Release cups were transferred to crates for transport to Tri Nguyen village via vehicle and boat. Release cups were maintained under ambient temperature conditions for 1.5 hours during transfer from the IPNT insectary to Tri Nguyen village.</p>
                <p>For the Vinh Luong releases in 2018, a separate 
                    <italic toggle="yes">w</italic>Mel 
                    <italic toggle="yes">Ae. aegypti</italic> line was created in the NIHE insectary as above, with the exception that infected females were mated to uninfected males (F1) collected from two locations in Nha Trang City (
                    <xref ref-type="table" rid="T1">Table 1</xref>). After backcrossing (six generations) the colony was then maintained with the addition of Nha Trang City wild type (F1) males at a ratio of 10&#x2013;20% per generation. Eggs were transferred via courier to the rearing facility at IPNT, where they were hatched and reared in trays (61 x 42 x 15 cm) containing 12 liters of tap water and were fed JBL NovoTab pellets (JBL, Neuhofen, Germany, Product number 302300). Larvae/pupae (100&#x2013;120) were placed into individual plastic cups (850 mL) containing 250 mL of tap water. When approximately 90% of larvae had pupated, a mesh cover was placed on each cup and adults were maintained for 3&#x2013;4 days on 20% sucrose solution. Release cups were transferred to crates for transport to the release site. Release cups were maintained under ambient temperature conditions for up to one hour during transfer from the IPNT insectary to Vinh Luong Ward.</p>
                <p>Prior to releases in Vinh Luong, the 
                    <italic toggle="yes">Wolbachia</italic> mosquito line was characterized in terms of key fitness traits including adult female fecundity, egg hatch rate and 
                    <italic toggle="yes">Wolbachia</italic> maternal transmission efficiency as described above. Insecticide susceptibility was also assessed using previously described methods (
                    <xref ref-type="bibr" rid="ref-53">WHO, 2013</xref>). Insecticide type and concentrations (
                    <xref ref-type="table" rid="T1">Table 1</xref>) were in line with recommendations for 
                    <italic toggle="yes">Ae. aegypti</italic> mosquitoes and followed the WHO standard bioassay method (
                    <xref ref-type="bibr" rid="ref-53">WHO, 2013</xref>). Insecticide impregnated papers were purchased from the WHO Collaborating Centre at the Universiti Sains Malaysia, Penang, Malaysia. Each test included five replicate tubes for each insecticide and two negative control tubes, with 20 female 
                    <italic toggle="yes">Ae. aegypti</italic> mosquitoes per tube. The mosquitoes were three to five days old, fed with sugar only. Mosquitoes were kept in a paper-free tube for one hour to adapt, transferred to the tube containing insecticide-impregnated paper for one hour, then transferred back to the holding tube, with access to sugar solution, for 24 hours.  Dead and live mosquitoes were counted after 24 hours.</p>
            </sec>
            <sec>
                <title>Releases</title>
                <p>For Tri Nguyen releases, base maps showing the location of each household along with the 47 release zones that were used to coordinate field activities during the previous release of the 
                    <italic toggle="yes">w</italic>MelPop 
                    <italic toggle="yes">Ae. aegypti</italic> (
                    <xref ref-type="bibr" rid="ref-18">Nguyen 
                        <italic toggle="yes">et al.</italic>, 2015</xref>) were updated. Local community members were invited to join the project as project &#x201c;collaborators&#x201d;. Many of the collaborators had worked on the previous project that involved the release of 
                    <italic toggle="yes">w</italic>MelPop 
                    <italic toggle="yes">Ae. aegypti.</italic> These 47 collaborators were trained in mosquito release and monitoring activities and were then responsible for undertaking release and monitoring activities within their respective zones. During releases, cups of 3&#x2013;4 day old adult mosquitoes (approx. 30 per cup) were transported by boat to the island each week. Each of the 47 project collaborators collected a box containing 9&#x2013;30 release cups, and undertook releases in their respective neighborhood zones. Mosquitoes were released between 8:00 and 10:00 am, outside of each house that agreed to participate in the releases. Releases commenced on 14 May 2014 and were undertaken each week for 27 weeks.</p>
                <p>For the Vinh Luong releases, release maps were created by overlaying a 50 x 50 m grid across the residential areas of the eight hamlets. During releases, cups containing 3&#x2013;4 day old adult mosquitoes (approx. 100&#x2013;120 per cup) were transported to the field via car, and then released by staff. One cup of mosquitoes was released inside each grid square each week (305 release grids). Mosquitoes were released between 07:30 and 10:30 hrs in shaded road-side locations. Releases commenced on 8 March 2018 and were undertaken each week, for 17 weeks.</p>
            </sec>
            <sec>
                <title>Community engagement</title>
                <p>For the Tri Nguyen releases, communication and engagement activities followed the methods described in 
                    <xref ref-type="bibr" rid="ref-14">McNaughton &amp; Duong (2014)</xref>. This included sharing of information with community leaders and representatives from all households, via community events and meetings (33 events and meetings), door-knocking and one-on-one meetings with householders who were not engaged through community event or meeting (85 households), open letters to every household (
                    <xref ref-type="bibr" rid="ref-45">Ryan, 2021s</xref>), and community loudspeaker announcements (three announcements). A community reference group was established, with representation from six hamlet leaders to facilitate engagement with householders and identify any issues or concerns. The community collaborator system, utilized as part of the previous release involving 
                    <italic toggle="yes">w</italic>MelPop 
                    <italic toggle="yes">Wolbachia</italic> mosquitoes in 2013 (
                    <xref ref-type="bibr" rid="ref-18">Nguyen 
                        <italic toggle="yes">et al.</italic>, 2015</xref>), was also re-established. Each collaborator was responsible for 10&#x2013;20 households and assisted with distributing newsletters, updating householders on progress and activities, and providing feedback to the community reference group. In addition, a school-based education campaign was undertaken with the local primary school, and involved a presentation to each class on dengue and 
                    <italic toggle="yes">Wolbachia</italic> and a drawing competition about the impact of dengue on the community. Local media were proactively engaged about the project activities, resulting in 20 media articles in local and national newspaper and television outlets.</p>
                <p>Prior to releases residents were asked to provide written consent for the release of 
                    <italic toggle="yes">Wolbachia</italic> mosquitoes around their houses. Of the 715 registered households, 695 (97.2%) agreed to participate and gave consent for the release of mosquitoes outside their houses, 4 (0.6%) households did not agree for releases outside their houses, and 16 households did not complete the consent form.</p>
                <p>For the Vinh Luong releases, communication and community engagement activities followed the Public Acceptance Model (PAM) as described in 
                    <xref ref-type="bibr" rid="ref-19">O'Neill 
                        <italic toggle="yes">et al.</italic> (2019)</xref>. The community engagement activities were undertaken over a two-year period and involved the following:</p>
                <p>1. Raising broad community and stakeholder awareness across Nha Trang City. Information was provided to residents and key stakeholders about 
                    <italic toggle="yes">Wolbachia</italic>, and mosquito releases and monitoring activities via various channels, including mass communication (the project&#x2019;s website, community loudspeaker system, newspapers, TV, radio), school outreach programs, direct engagement with the local governments at different levels of administration, and community events using the existing community networks (heads and health collaborators of hamlets).</p>
                <p>2. Quantitative surveys to assess community support in Vinh Luong. Three cross-sectional surveys were undertaken using a stratified random sampling method with the sample size of 370 participants (different participants for each of the surveys). Two pre-release surveys were undertaken prior to and after conducting communication and engagement activities. A follow-up post-release survey was undertaken three months after the start of mosquito releases. The initial pre-release survey prior to commencement of communication and engagement activities indicated high householder support and willingness to participate in releases (66.2%), or support for releases but not direct participation in releases (25.1%). A small proportion of householders were undecided whether they supported mosquito releases (6.5%), and only eight (2.2%) households indicated they did not support releases. After completion of the communication and engagement activities, the pre-release survey indicated householder support and willingness to participate had increased (83.8%), and support for releases but not direct participation in releases was 13.2%. Only a small proportion of householders were undecided whether they supported mosquito releases (2.4%), and only two (0.5%) households indicated they did not support releases. Similar results were found in the post-release survey undertaken three months after commencement of releases (88.1% of households support and willing to participate; 7.0% of households support but not willing to participate; 4.1% undecided whether they support releases; three households [0.8%] indicated they did not support releases).</p>
                <p>3. Establishment of an issues management system. The system enabled community members to easily contact the project with any questions and concerns and have them quickly addressed by project staff typically within 24 hours of receipt. The system also allowed residents to opt in or out of direct participation in release and monitoring activities.</p>
                <p>4. Community reference group. A community reference group was established with representatives from government organizations and community unions in Nha Trang City. The reference group&#x2019;s function was to independently review activities to ensure that engagement was carried out in accordance with our stated Public Participation Principles (
                    <xref ref-type="bibr" rid="ref-19">O&#x2019;Neill 
                        <italic toggle="yes">et al.</italic>, 2019</xref>).</p>
                <p>As a requirement for institutional review board (IRB) approval, informed consent for the release of 
                    <italic toggle="yes">Wolbachia</italic> mosquitoes was obtained from a subsample of households (n=370) in Vinh Luong. Participating households were the same as those that participated in the 2nd pre-release survey of community acceptance as described in 2) above. Participation of households was voluntary, with the head (or representative) of each household asked to provide individual consent to undertake 
                    <italic toggle="yes">Wolbachia</italic> mosquito releases in their community. Of the 370 households, 100% completed the consent form, with all households providing consent for the release of mosquitoes in their community. In addition, 10 community meetings were held with representatives from households from each hamlet (total of 828 household participants), with verbal approval for releases from 100% of participants. Final written approval for releases was provided by the local authority, after reviewing the results from community engagement, and feedback from the community reference group.</p>
            </sec>
            <sec>
                <title>Field monitoring</title>
                <p>Adult mosquito collections were undertaken during and after releases using BG Sentinel (BGS) traps (Biogents AG, Regensburg, Germany, Product number NR10030). The number and density of BGS traps in each area varied over time. In Tri Nguyen, initially 45&#x2013;50 BGS traps were distributed throughout the release area (approximately two BGS traps per ha). After 41 months, this was reduced to 20 BGS traps (approximately one BGS trap per ha). In Vinh Luong, initially 42 BGS traps were distributed throughout the release area (approximately one BGS trap per 2.5 ha). After 15 months this was reduced to 15&#x2013;20 BGS traps (approximately one BGS trap per 5 ha). Mosquitoes were collected from the BGS traps every 1&#x2013;2 weeks and returned to the laboratory for sorting, morphological identification and counting. 
                    <italic toggle="yes">Aedes aegypti</italic> samples were stored in 70% ethanol prior to screening for 
                    <italic toggle="yes">Wolbachia</italic> infection status. After completion of releases, BGS trap sampling was undertaken every one to four weeks for 33 months in Tri Nguyen, and for 18 months in Vinh Luong, after which time BGS trap sampling was undertaken periodically at 6&#x2013;12 months intervals. During 2020, BGS trap sampling was disrupted due to social distancing requirements in response to COVID-19, with sampling recommencing in Vinh Luong in November 2020, and in Tri Nguyen in April 2021.</p>
            </sec>
            <sec>
                <title>
                    <italic toggle="yes">Wolbachia</italic> maternal transmission assessments on field collected material from Tri Nguyen</title>
                <p>Two separate collections were undertaken, the first in May 2015 involving surveys at 48 households, with collections from the four most common container types found in Tri Nguyen (
                    <xref ref-type="bibr" rid="ref-12">Knox 
                        <italic toggle="yes">et al.</italic>, 2007</xref>): concrete rainwater tanks (&gt; 500 L), plastic 200 L drums, ceramic 100 L jars and vases (&lt; 1 L) used for religious purposes (i.e. ancestral shrines in homes). The second survey was undertaken in May 2016 with collections from 200 L drums only. Samples of IV instars and pupae were collected from containers using a 200 mm diameter sampling net (100 &#x00b5;m zoological plankton mesh).</p>
                <p>IV instars/pupae were returned to the laboratory and each IV instar/pupae was placed into an individual container and allowed to emerge. Males were discarded and up to 10 individual virgin females from each container were placed into a small cage. Into each cage 10 
                    <italic toggle="yes">Wolbachia</italic> uninfected Nha Trang City colony (F1) males were added and allowed to mate with virgin females over a 24 h period. Mosquitoes were blood fed and the progeny were processed as described previously, except immatures were fed on JBL NovoTab fish food (JBL NovoTab, Neuhofen, Germany, Product number 302300).</p>
            </sec>
            <sec>
                <title>Container surveys in Tri Nguyen</title>
                <p>To determine whether there was any association between the abundance of different container types and the prevalence of 
                    <italic toggle="yes">Wolbachia</italic> across Tri Nguyen, a container survey was undertaken in November 2015. Houses were selected from a list of 715 registered households in Tri Nguyen village, with selection of every fifth house. A total of 143 houses were selected, representing 20% of registered houses across the north (n=62), center (n=47) and south (n=40) areas. Samples of late instars and pupae were collected from all water holding containers using a 200 mm diameter sampling net (100 &#x00b5;m zoological plankton mesh) (
                    <xref ref-type="bibr" rid="ref-12">Knox 
                        <italic toggle="yes">et al.</italic>, 2007</xref>). Field container types were categorized according to the following: concrete rainwater tanks (&gt; 500 L), plastic 200 L drums, ceramic 100 L jars, buckets (&lt;10 L) and vases (&lt; 1 L) used for religious purposes (i.e. ancestral shrines in homes), and other miscellaneous containers (discarded items, ant traps, etc). Up to 10 individuals were collected from each container and samples were then transferred to 70% ethanol prior to processing for 
                    <italic toggle="yes">Wolbachia</italic> infection using a Taqman qPCR assay (
                    <xref ref-type="bibr" rid="ref-4">Dar 
                        <italic toggle="yes">et al.</italic>, 2008</xref>; 
                    <xref ref-type="bibr" rid="ref-19">O&#x2019;Neill 
                        <italic toggle="yes">et al.</italic>, 2019</xref>; 
                    <xref ref-type="bibr" rid="ref-55">Yeap 
                        <italic toggle="yes">et al.</italic>, 2014</xref>).</p>
                <p>To determine whether there was any association between abiotic water characteristics in different container types and the prevalence of 
                    <italic toggle="yes">Wolbachia</italic> across Tri Nguyen, an abiotic survey of water quality in containers was undertaken in June 2016. The survey was undertaken across a transect of houses from the north (24 houses), center (13 houses) and south (13 houses) areas. Houses were randomly selected across from a north-south transect, and samples of late instars and pupae were collected from different types of containers as above. A water sample from each container was collected and tested for pH, salinity and conductivity using a handheld water quality meter (PCSTestr 35, Eutech Instruments, Singapore).</p>
            </sec>
            <sec>
                <title>Diagnostic screening of samples for 
                    <italic toggle="yes">Wolbachia</italic>
                </title>
                <p>Colony, field collected mosquitoes from BGS traps, larval samples from field containers, and samples from maternal transmission were screened for 
                    <italic toggle="yes">Wolbachia</italic> using Taqman qPCR on a Roche LightCycler 480 using an internally controlled qualitative assay for the presence or absence of 
                    <italic toggle="yes">Wolbachia</italic> as previously described (
                    <xref ref-type="bibr" rid="ref-4">Dar 
                        <italic toggle="yes">et al.</italic>, 2008</xref>; 
                    <xref ref-type="bibr" rid="ref-19">O&#x2019;Neill 
                        <italic toggle="yes">et al.</italic>, 2019</xref>; 
                    <xref ref-type="bibr" rid="ref-55">Yeap 
                        <italic toggle="yes">et al.</italic>, 2014</xref>). TM513 primers and probe were used for Tri Nguyen samples to keep consistency with primary results and WSP primers and probe was used for Vinh Luong ward to reduce the possible effect of gene copy number variation in comparison with WS0513 gene. The qPCR cycling program consisted of a denaturation at 95&#x00b0;C for 5 min followed by 45 cycles of PCR (denaturation at 95&#x00b0;C for 10 sec, annealing at 60&#x00b0;C for 15 sec, and extension at 72&#x00b0;C for 1 sec with single acquisition) followed by a cooling down step at 40&#x00b0;C for 10 sec. Using the data generated for the presence-absence of 
                    <italic toggle="yes">Wolbachia</italic>, the relative density of 
                    <italic toggle="yes">Wolbachia</italic> per cell was calculated using the Advanced Relative Quantification (&#x2206;&#x2206;C
                    <sub>T</sub>- Method) function within the Roche LightCycler 480 Software.</p>
            </sec>
            <sec>
                <title>Weather data</title>
                <p>Meteorological data including maximum, minimum and average daily temperature records and daily rainfall for Nha Trang City (Station ID 48877099999) were obtained from the 
                    <ext-link ext-link-type="uri" xlink:href="http://www.ncei.noaa.gov/access/search/data-search/global-hourly">National Centers for Environmental Information, National Oceanic and Atmospheric Administration</ext-link> (
                    <xref ref-type="bibr" rid="ref-15">Menne 
                        <italic toggle="yes">et al.</italic>, 2012a</xref>; 
                    <xref ref-type="bibr" rid="ref-16">Menne 
                        <italic toggle="yes">et al.</italic>, 2012b</xref>). Local temperature data was collected from inside houses in Tri Nguyen and Vinh Luong using temperature data loggers. Houses for hosting the temperature data loggers were selected from the list of BG sentinel houses based on their geographic coverage across the representative release areas. In Tri Nguyen, six data loggers (EasyLog EL-USB-2, Lascar Electronics, Kowloon, Hong Kong) were used to record hourly temperatures inside houses (two houses in each of north, center and south areas) between May 2014 and June 2017. From July 2017 to June 2019 the EasyLog EL-USB-2 data loggers above were replaced with 10 iButtons (iButton DS1923, Maxim Integrated, San Jose, CA USA). These were set to record hourly temperatures inside houses and were located in six houses in the north, one in the center, and three in the south. In Vinh Luong, 10 iButton (iButton DS1923, Maxim Integrated, San Jose, CA USA) temperature data loggers were used to record hourly temperatures in 10 houses from March 2018 to October 2019, and from November 2020 to April 2021.</p>
            </sec>
            <sec>
                <title>Ethical considerations and consent</title>
                <p>The release of 
                    <italic toggle="yes">Wolbachia</italic> mosquitoes at Tri Nguyen, along with human blood feeding of mosquitoes, was approved by the institutional review board (IRB) of the National Institute of Hygiene and Epidemiology (Approval reference number: 32/HDD 15/12/2011) and then the IRB of Vietnam Ministry of Health (Approval reference number: 38/CN-BDGDD 04/04/2014). Volunteer bloodfeeders provided informed written consent (no children were involved). For releases, residents were asked to provide written consent for the release of 
                    <italic toggle="yes">Wolbachia</italic> mosquitoes around their houses. In Vinh Luong, the release of 
                    <italic toggle="yes">Wolbachia</italic> mosquitoes along with human blood feeding of mosquitoes, was approved by the IRBs of the National Institute of Hygiene and Epidemiology (Approval reference number: IRB-VN01057-19/2017 12/10/2017) and Vietnam Ministry of Health (Approval reference number: 151/CN-BDGDD 28/12/2017). In Vinh Luong, the head (or representative) of 370 randomly selected households was asked to provide written consent to undertake 
                    <italic toggle="yes">Wolbachia</italic> mosquito releases in their community.</p>
            </sec>
            <sec>
                <title>Statistical analysis</title>
                <p>The number of 
                    <italic toggle="yes">Ae. aegypti</italic> mosquitoes caught over time was summarized as the mean count per BGS trap per week, in each of the three Tri Nguyen areas (north, central, south) and in Vinh Luong. Mixed-effects negative binomial regression was used to compare the number of 
                    <italic toggle="yes">Ae. aegypti</italic> caught per BGS trap per week, between pre- and post-release periods, with the inclusion of BGS trap as a random effect to account for clustering at the trap level. All analyses included a binary indicator for hot/cool season as a covariate (hot season = May - October; cool season November - April). The count ratio produced by the negative binomial regression model is the ratio of the mean number of 
                    <italic toggle="yes">Ae. aegypti</italic> caught per trap per week between areas or between release vs non-release periods. Data was analyzed by release status: pre-release, during release, and post-release, and between sites for the total observation period. Analysis of the total observation period was done with the inclusion of an indicator for release status as a covariate.</p>
                <p>The density of 
                    <italic toggle="yes">Wolbachia</italic> in 
                    <italic toggle="yes">Ae. aegypti</italic> caught over time was summarized as the median relative density value in 
                    <italic toggle="yes">Ae. aegypti</italic> caught each week during the post-release period, in each of the three Tri Nguyen areas (north, central, south) and in Vinh Luong. A distributed lag linear regression model was used to fit weekly median 
                    <italic toggle="yes">Wolbachia</italic> density to the mean daily temperature measured inside houses. The model included values of weekly mean daily temperature lagged up to 5 weeks for the three Tri Nguyen areas and 4 weeks for Vinh Luong, with maximum lag determined using the Akaike Information Criterion (AIC). Newey-West standard errors were calculated to account for autocorrelation in weekly median 
                    <italic toggle="yes">Wolbachia</italic> density, with maximum lag 9 for the three Tri Nguyen areas and maximum lag 5 for Vinh Luong.</p>
            </sec>
        </sec>
        <sec sec-type="results | discussion">
            <title>Results and discussion</title>
            <sec>
                <title>Tri Nguyen</title>
                <p>Releases of 
                    <italic toggle="yes">w</italic>Mel 
                    <italic toggle="yes">Wolbachia Ae. aegypti</italic> mosquitoes in Tri Nguyen were undertaken weekly for 27 weeks, with an average of 32.4 mosquitoes released per house per week (range 12.8 to 93.7 per house per week) (
                    <xref ref-type="fig" rid="f4">Figure 4</xref>). In release weeks 8&#x2013;9 (mid-July 2014) the 
                    <italic toggle="yes">Wolbachia</italic> prevalence in mosquitoes in BG traps in the north (34.1&#x2013;38.3%) and central areas (28.7&#x2013;41.9%) were low (
                    <xref ref-type="fig" rid="f6">Figure 6</xref>), and release numbers were increased from week 11 (average 52.7 per house week) for 5&#x2013;6 weeks in the central and south areas, and for the remainder of the releases in the north area (
                    <xref ref-type="fig" rid="f4">Figure 4</xref>). By the end of 27 weeks of releases (14 November 2014) the 
                    <italic toggle="yes">Wolbachia</italic> infection prevalence in mosquitoes ranged from 77.3% to 86.6% across the three areas (
                    <xref ref-type="fig" rid="f6">Figure 6</xref>, 
                    <xref ref-type="fig" rid="f8">Figure 8</xref>). Over the next six months the 
                    <italic toggle="yes">Wolbachia</italic> infection prevalence in mosquitoes remained high and increased to 91.7&#x2013;96.6% by mid-May 2015.</p>
                <fig fig-type="figure" id="f4" orientation="portrait" position="float">
                    <label>Figure 4. </label>
                    <caption>
                        <title>Mean numbers of 
                            <italic toggle="yes">Wolbachia</italic> mosquitoes released per house per week (black bars), and total numbers of 
                            <italic toggle="yes">Wolbachia</italic> mosquitoes released (red circles) in north, center and south areas in Tri Nguyen.</title>
                    </caption>
                    <graphic orientation="portrait" position="float" xlink:href="https://gatesopenresearch-files.f1000.com/manuscripts/14782/28024d43-fd50-43c9-ad0e-5c5cf9dd8b7a_figure4.gif"/>
                </fig>
                <p>From June to December 2015, the 
                    <italic toggle="yes">Wolbachia</italic> infection prevalence in mosquitoes decreased to 22.5%, 26.3% and 55.4% in the north, central and south areas, respectively (
                    <xref ref-type="fig" rid="f6">Figure 6</xref>, 
                    <xref ref-type="fig" rid="f8">Figure 8</xref>). This period corresponded with the hot dry-season months from June to September, with average weekly temperatures in Nha Trang of 28.2&#x2013;30.5&#x00b0;C, and average weekly maximum temperatures of 31.3&#x2013;33.8&#x00b0;C. Monsoon rains occurred from October to December in Central Vietnam, and by December 2015 the weekly temperatures in Nha Trang had decreased to 26.3&#x00b0;C, and median weekly temperatures inside houses had decreased to 28&#x00b0;C. From January to May 2016, 
                    <italic toggle="yes">Wolbachia</italic> infection prevalence in mosquitoes in the north, central and south areas increased to 46.9, 40.9 and 94.1%, respectively (
                    <xref ref-type="fig" rid="f6">Figure 6</xref>). During the following hot dry-season months from June to September 2016, 
                    <italic toggle="yes">Wolbachia</italic> infection prevalence decreased, and by the end of the monsoon rains in December 2016 
                    <italic toggle="yes">Wolbachia</italic> infection prevalence was very low in the north (2.9%) and central areas (9.2%), yet remained high in the south area (75.0%) (
                    <xref ref-type="fig" rid="f6">Figure 6</xref>, 
                    <xref ref-type="fig" rid="f8">Figure 8</xref>).</p>
                <p>From January 2017, 
                    <italic toggle="yes">Wolbachia</italic> infection prevalence in mosquitoes in the north was less than 10.1%, with no 
                    <italic toggle="yes">Wolbachia</italic> infection detected in mosquitoes except for mosquitoes from single trap collected in April 2021 (
                    <xref ref-type="fig" rid="f6">Figure 6</xref>, 
                    <xref ref-type="fig" rid="f9">Figure 9</xref>). In the central area, 
                    <italic toggle="yes">Wolbachia</italic> infection prevalence ranged between 6.6&#x2013;58.3% between January 2017 to December 2018, but remained less than 5.1% from January 2019 onwards. In the south area, 
                    <italic toggle="yes">Wolbachia</italic> infection prevalence remained high with an average of 81.6% (range 46.8&#x2013;97.7%). Infection levels below 20% are below the estimated unstable equilibrium point for 
                    <italic toggle="yes">w</italic>Mel in Cairns Australia (20&#x2013;30%; 
                    <xref ref-type="bibr" rid="ref-9">Hoffmann 
                        <italic toggle="yes">et al.</italic>, 2011</xref>; 
                    <xref ref-type="bibr" rid="ref-49">Turelli &amp; Barton, 2017</xref>); below this frequency threshold, 
                    <italic toggle="yes">Wolbachia</italic> infection frequency is expected to decline. The seasonal oscillations in 
                    <italic toggle="yes">Wolbachia</italic> infection frequencies in the south area (50&#x2013;100%) did not approach the unstable equilibrium point, and this allowed for seasonal increases in 
                    <italic toggle="yes">Wolbachia</italic> infection frequencies in mosquitoes. In contrast, in the north and central areas, where the 
                    <italic toggle="yes">Wolbachia</italic> infection prevalence first declined to less than 20% in September 2016, the prevalence of 
                    <italic toggle="yes">Wolbachia</italic> generally declined thereafter (
                    <xref ref-type="fig" rid="f6">Figure 6</xref>, 
                    <xref ref-type="fig" rid="f8">Figure 8</xref>, 
                    <xref ref-type="fig" rid="f9">Figure 9</xref>).</p>
                <p>Overall, temperatures inside houses in Tri Nguyen were generally higher than the Nha Trang City meteorological data. Median weekly temperatures inside houses in Tri Nguyen were  1.7 +/- 0.6&#x00b0;C (s.d.) higher than the mean weekly temperatures in Nha Trang City, with median temperatures inside houses (31.0&#x2013;32.5&#x00b0;C) during the hottest months approaching the mean weekly maximum temperatures in Nha Trang City.</p>
                <p>To determine whether mosquitoes exposed to field conditions in Tri Nguyen had reduced maternal transmission of 
                    <italic toggle="yes">Wolbachia</italic> from infected females to their offspring, collections of late instars and pupae were made from different types of field containers and emergent adult females were assessed for efficiency of 
                    <italic toggle="yes">Wolbachia</italic> maternal transmission (
                    <xref ref-type="table" rid="T2">Table 2</xref>). In May 2015 when median weekly temperatures in houses were at their highest (30.5&#x2013;32.5&#x00b0;C), imperfect 
                    <italic toggle="yes">Wolbachia</italic> maternal transmission was found across all three areas, with 53.6&#x2013;69.0% of progeny from 
                    <italic toggle="yes">Wolbachia</italic>-infected females found to be positive for 
                    <italic toggle="yes">Wolbachia</italic>. There was no clear association between the type of container that females were collected from and maternal transmission. Repeat collections from drums in the north and south areas in May 2016, when median weekly temperatures were similarly high (31.5&#x2013;32.5&#x00b0;C), found imperfect maternal transmission of 
                    <italic toggle="yes">Wolbachia</italic> from infected females, with only 16.7% and 60.5% of progeny from 
                    <italic toggle="yes">Wolbachia</italic> infected females found to be positive for 
                    <italic toggle="yes">Wolbachia</italic>, from the north and south areas, respectively.</p>
                <table-wrap id="T2" orientation="portrait" position="anchor">
                    <label>Table 2. </label>
                    <caption>
                        <title>
                            <italic toggle="yes">Wolbachia</italic> maternal transmission rates in female 
                            <italic toggle="yes">Aedes aegypti</italic> sourced as IV instars/pupae from different locations and container types in Tri Nguyen, May 2015 and May 2016.</title>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="center" colspan="1" rowspan="2">Area</th>
                                <th align="center" colspan="1" rowspan="2">Container
                                    <break/> Type</th>
                                <th align="center" colspan="1" rowspan="2">Number of
                                    <break/> containers
                                    <break/> sampled</th>
                                <th align="center" colspan="1" rowspan="2">Number of 
                                    <break/>containers maternal
                                    <break/> transmission
                                    <break/> assessed</th>
                                <th align="center" colspan="1" rowspan="2">Number
                                    <break/> progeny 
                                    <break/>tested</th>
                                <th align="center" colspan="1" rowspan="2">Number 
                                    <break/>progeny 
                                    <break/>
                                    <italic toggle="yes">Wolbachia</italic> +ve</th>
                                <th align="center" colspan="2" rowspan="1">Maternal transmission</th>
                            </tr>
                            <tr>
                                <th align="right" colspan="1" rowspan="1" valign="top">Percent</th>
                                <th align="left" colspan="1" rowspan="1" valign="top">(Range
                                    <sup>
                                        <xref ref-type="other" rid="FN1">1</xref>
                                    </sup>)</th>
                            </tr>
                            <tr>
                                <th align="left" colspan="7" rowspan="1" valign="top">
                                    <italic toggle="yes">May 2015 Collection Period</italic>
                                </th>
                                <th align="center" colspan="1" rowspan="1" valign="top">&#x00a0;</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">North</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Vase</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">3</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">2</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">34</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">34</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">100.0 </td>
                                <td align="center" colspan="1" rowspan="1" valign="top">(100.0-100.0)</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top">Jar</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">4</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">3</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">217</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">109</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">50.2</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">(0-100.0)</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top">Drum</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">4</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">3</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">274</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">194</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">70.8 </td>
                                <td align="center" colspan="1" rowspan="1" valign="top">(20.0-100.0)</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top">Tank</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">4</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">2</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">15</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">13</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">86.7 </td>
                                <td align="center" colspan="1" rowspan="1" valign="top">(60.0-100.0)</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <bold>Sub total</bold>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="right" colspan="1" rowspan="1" valign="top">
                                    <bold>15</bold>
                                </td>
                                <td align="right" colspan="1" rowspan="1" valign="top">
                                    <bold>10</bold>
                                </td>
                                <td align="right" colspan="1" rowspan="1" valign="top">
                                    <bold>540</bold>
                                </td>
                                <td align="right" colspan="1" rowspan="1" valign="top">
                                    <bold>350</bold>
                                </td>
                                <td align="right" colspan="1" rowspan="1" valign="top">
                                    <bold>64.8</bold>
                                </td>
                                <td align="center" colspan="1" rowspan="1" valign="top">&#x00a0;</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Center</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Vase</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">5</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">2</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">78</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">36</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">46.2 </td>
                                <td align="center" colspan="1" rowspan="1" valign="top">(0-100.0)</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top">Jar</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">5</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">2</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">286</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">221</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">77.3</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">(0-100.0)</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top">Drum</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">5</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">4</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">74</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">53</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">71.6 </td>
                                <td align="center" colspan="1" rowspan="1" valign="top">(0-100.0)</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top">Tank</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">4</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">2</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">54</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">40</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">74.1 </td>
                                <td align="center" colspan="1" rowspan="1" valign="top">(0-100.0)</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <bold>Sub total</bold>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="right" colspan="1" rowspan="1" valign="top">
                                    <bold>19</bold>
                                </td>
                                <td align="right" colspan="1" rowspan="1" valign="top">
                                    <bold>10</bold>
                                </td>
                                <td align="right" colspan="1" rowspan="1" valign="top">
                                    <bold>492</bold>
                                </td>
                                <td align="right" colspan="1" rowspan="1" valign="top">
                                    <bold>350</bold>
                                </td>
                                <td align="right" colspan="1" rowspan="1" valign="top">
                                    <bold>71.1</bold>
                                </td>
                                <td align="center" colspan="1" rowspan="1" valign="top">&#x00a0;</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">South</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Vase</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">9</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">3</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">125</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">35</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">28.0 </td>
                                <td align="center" colspan="1" rowspan="1" valign="top">(0-85.0)</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top">Jar</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">3</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">2</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">80</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">62</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">77.5 </td>
                                <td align="center" colspan="1" rowspan="1" valign="top">(60.100.0)</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top">Drum</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">5</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">2</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">60</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">45</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">75.0 </td>
                                <td align="center" colspan="1" rowspan="1" valign="top">(40.0-85.0)</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top">Tank</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">0</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">0</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">0</td>
                                <td align="right" colspan="1" rowspan="1" valign="top"/>
                                <td align="center" colspan="1" rowspan="1" valign="top">&#x00a0;</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <bold>Sub total</bold>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="right" colspan="1" rowspan="1" valign="top">
                                    <bold>18</bold>
                                </td>
                                <td align="right" colspan="1" rowspan="1" valign="top">
                                    <bold>7</bold>
                                </td>
                                <td align="right" colspan="1" rowspan="1" valign="top">
                                    <bold>265</bold>
                                </td>
                                <td align="right" colspan="1" rowspan="1" valign="top">
                                    <bold>142</bold>
                                </td>
                                <td align="right" colspan="1" rowspan="1" valign="top">
                                    <bold>53.6</bold>
                                </td>
                                <td align="center" colspan="1" rowspan="1" valign="top">&#x00a0;</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <bold>Total</bold>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="right" colspan="1" rowspan="1" valign="top">
                                    <bold>52</bold>
                                </td>
                                <td align="right" colspan="1" rowspan="1" valign="top">
                                    <bold>27</bold>
                                </td>
                                <td align="right" colspan="1" rowspan="1" valign="top">
                                    <bold>1,297</bold>
                                </td>
                                <td align="right" colspan="1" rowspan="1" valign="top">
                                    <bold>842</bold>
                                </td>
                                <td align="right" colspan="1" rowspan="1" valign="top">
                                    <bold>64.9</bold>
                                </td>
                                <td align="center" colspan="1" rowspan="1" valign="top">&#x00a0;</td>
                            </tr>
                            <tr>
                                <th align="left" colspan="7" rowspan="1" valign="top">
                                    <italic toggle="yes">May 2016 Collection Period</italic>
                                </th>
                                <th align="center" colspan="1" rowspan="1" valign="top">&#x00a0;</th>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">North</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Drum</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">12</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">3</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">30</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">5</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">16.7 </td>
                                <td align="center" colspan="1" rowspan="1" valign="top">(0-50.0)</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">South</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Drum</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">11</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">4</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">195</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">118</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">60.5 </td>
                                <td align="center" colspan="1" rowspan="1" valign="top">(0-100.0)</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <bold>Total</bold>
                                </td>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="right" colspan="1" rowspan="1" valign="top">
                                    <bold>23</bold>
                                </td>
                                <td align="right" colspan="1" rowspan="1" valign="top">
                                    <bold>7</bold>
                                </td>
                                <td align="right" colspan="1" rowspan="1" valign="top">
                                    <bold>225</bold>
                                </td>
                                <td align="right" colspan="1" rowspan="1" valign="top">
                                    <bold>123</bold>
                                </td>
                                <td align="right" colspan="1" rowspan="1" valign="top">
                                    <bold>54.7</bold>
                                </td>
                                <td align="center" colspan="1" rowspan="1" valign="top">&#x00a0;</td>
                            </tr>
                        </tbody>
                    </table>
                    <table-wrap-foot>
                        <fn>
                            <p id="FN1">
                                <sup>1</sup> Percent maternal transmission per female </p>
                        </fn>
                    </table-wrap-foot>
                </table-wrap>
                <p>To investigate possible factors influencing the heterogeneity in 
                    <italic toggle="yes">Wolbachia</italic> infection prevalence in Tri Nguyen, container surveys were undertaken in November 2015 (
                    <xref ref-type="table" rid="T3">Table 3</xref>). Houses in the north area had the highest mean numbers of containers per house (13.0), compared with houses in the central (11.5) and south areas (8.2). The prevalence of 
                    <italic toggle="yes">Ae. aegypti</italic> immatures in containers was high in all areas, ranging from 17.2&#x2013;23.1% of surveyed containers. 
                    <italic toggle="yes">Wolbachia</italic> infection prevalence in immatures from different container types ranged from 15.5&#x2013;41.4% in the north, 22.5&#x2013;35.5% in the center, and 56.7&#x2013;92.9% in the south. Overall, the 
                    <italic toggle="yes">Wolbachia</italic> infection prevalence in immature stages collected from containers in the different areas matched those found in adult 
                    <italic toggle="yes">Ae. aegypti</italic> collected in BGS traps during November 2015 (north 26.1&#x2013;38.8%; center 23.8&#x2013;38.8%, south 58.7&#x2013;76.9%). The 
                    <italic toggle="yes">Wolbachia</italic> infection prevalence in 
                    <italic toggle="yes">Ae. aegypti</italic> immatures, pooled at the house level, shows significant spatial heterogeneity in 
                    <italic toggle="yes">Wolbachia</italic> infection prevalence (
                    <xref ref-type="fig" rid="f11">Figure 11</xref>). Container surveys in June 2016 found slightly elevated pH (7.93&#x2013;7.96), salinity (1.4&#x2013;2.0 ppt) and conductivity (2525&#x2013;3512) levels in water in containers in the central and the south areas, compared to the north (
                    <xref ref-type="table" rid="T4">Table 4</xref>).</p>
                <table-wrap id="T3" orientation="portrait" position="anchor">
                    <label>Table 3. </label>
                    <caption>
                        <title>Water container surveys in Tri Nguyen - prevalence of 
                            <italic toggle="yes">Ae. aegypti</italic> immatures and 
                            <italic toggle="yes">Wolbachia</italic> infection in III/IV instars and pupae collected from field containers in northern, central and southern areas in November 2015.</title>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="center" colspan="1" rowspan="2" valign="top">Area</th>
                                <th align="center" colspan="1" rowspan="2" valign="top"># Houses 
                                    <break/>surveyed</th>
                                <th align="center" colspan="1" rowspan="2" valign="top">Container
                                    <break/> type</th>
                                <th align="center" colspan="1" rowspan="2" valign="top">Mean 
                                    <break/>cont. per 
                                    <break/>house</th>
                                <th align="center" colspan="1" rowspan="2" valign="top">Number 
                                    <break/>cont.
                                    <break/> surveyed</th>
                                <th align="center" colspan="1" rowspan="2" valign="top">Number 
                                    <break/>cont. +ve 
                                    <break/>
                                    <italic toggle="yes">Ae. aegypti</italic>
                                </th>
                                <th align="center" colspan="1" rowspan="2" valign="top">% cont. +ve 
                                    <break/>
                                    <italic toggle="yes">Ae. aegypti</italic>
                                </th>
                                <th align="center" colspan="4" rowspan="1" valign="top">
                                    <italic toggle="yes">Wolbachia</italic> prevalence</th>
                            </tr>
                            <tr>
                                <th align="center" colspan="1" rowspan="1" valign="top">Number cont. 
                                    <break/>screened for 
                                    <break/>
                                    <italic toggle="yes">Wolbachia</italic>
                                </th>
                                <th align="center" colspan="1" rowspan="1" valign="top">Number immatures 
                                    <break/>screened for
                                    <break/> 
                                    <italic toggle="yes">Wolbachia</italic>
                                </th>
                                <th align="center" colspan="1" rowspan="1" valign="top">Number 
                                    <break/>immatures +ve 
                                    <break/>
                                    <italic toggle="yes">Wolbachia</italic>
                                </th>
                                <th align="center" colspan="1" rowspan="1" valign="top">% 
                                    <italic toggle="yes">Wolbachia</italic> 
                                    <break/>infection in
                                    <break/> immatures</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">North</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">62</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Tanks</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">2.4</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">146</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">26</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">17.8</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">26</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">225</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">53</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">23.6</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top">Drums</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">4.3</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">266</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">57</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">21.4</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">57</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">442</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">133</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">30.1</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top">Jars</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">0.6</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">35</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">13</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">37.1</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">13</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">122</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">41</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">33.6</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top">Buckets</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">3.3</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">206</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">20</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">9.7</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">20</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">142</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">22</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">15.5</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top">Vases</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">1.3</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">82</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">12</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">14.6</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">12</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">101</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">22</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">21.8</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top">Other</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">1.2</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">74</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">7</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">9.5</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">7</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">58</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">24</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">41.4</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <bold>Subtotal</bold>
                                </td>
                                <td align="right" colspan="1" rowspan="1" valign="top">
                                    <bold>13.0</bold>
                                </td>
                                <td align="right" colspan="1" rowspan="1" valign="top">
                                    <bold>809</bold>
                                </td>
                                <td align="right" colspan="1" rowspan="1" valign="top">
                                    <bold>135</bold>
                                </td>
                                <td align="right" colspan="1" rowspan="1" valign="top">
                                    <bold>16.7</bold>
                                </td>
                                <td align="right" colspan="1" rowspan="1" valign="top">
                                    <bold>135</bold>
                                </td>
                                <td align="right" colspan="1" rowspan="1" valign="top">
                                    <bold>1,090</bold>
                                </td>
                                <td align="right" colspan="1" rowspan="1" valign="top">
                                    <bold>295</bold>
                                </td>
                                <td align="right" colspan="1" rowspan="1" valign="top">
                                    <bold>27.1</bold>
                                </td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Center</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">47</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Tanks</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">2.1</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">99</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">22</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">28.2</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">28</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">233</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">46</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">19.7</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top">Drums</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">3.1</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">147</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">41</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">27.9</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">41</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">350</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">94</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">26.9</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top">Jars</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">1.3</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">63</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">25</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">39.7</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">25</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">228</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">81</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">35.5</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top">Buckets</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">2.9</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">138</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">21</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">15.2</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">21</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">171</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">44</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">25.7</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top">Vases</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">0.9</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">41</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">3</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">7.3</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">3</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">22</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">7</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">31.8</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top">Other</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">1.1</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">52</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">4</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">7.7</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">4</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">40</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">9</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">22.5</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <bold>Subtotal</bold>
                                </td>
                                <td align="right" colspan="1" rowspan="1" valign="top">
                                    <bold>11.5</bold>
                                </td>
                                <td align="right" colspan="1" rowspan="1" valign="top">
                                    <bold>540</bold>
                                </td>
                                <td align="right" colspan="1" rowspan="1" valign="top">
                                    <bold>122</bold>
                                </td>
                                <td align="right" colspan="1" rowspan="1" valign="top">
                                    <bold>22.6</bold>
                                </td>
                                <td align="right" colspan="1" rowspan="1" valign="top">
                                    <bold>122</bold>
                                </td>
                                <td align="right" colspan="1" rowspan="1" valign="top">
                                    <bold>1044</bold>
                                </td>
                                <td align="right" colspan="1" rowspan="1" valign="top">
                                    <bold>281</bold>
                                </td>
                                <td align="right" colspan="1" rowspan="1" valign="top">
                                    <bold>26.9</bold>
                                </td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">South</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">40</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Tanks</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">2.3</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">93</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">19</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">20.4</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">18</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">160</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">110</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">68.8</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top">Drums</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">2.4</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">97</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">30</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">30.9</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">30</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">253</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">181</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">71.5</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top">Jars</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">0.6</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">25</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">12</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">48.0</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">12</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">92</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">74</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">80.4</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top">Buckets</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">1.5</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">59</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">9</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">15.3</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">9</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">67</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">38</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">56.7</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top">Vases</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">0.8</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">31</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">3.2</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">0</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">0</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">0</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">&#x00a0;</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top">Other</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">0.6</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">24</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">2</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">8.3</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">2</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">14</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">13</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">92.9</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <bold>Subtotal</bold>
                                </td>
                                <td align="right" colspan="1" rowspan="1" valign="top">
                                    <bold>8.2</bold>
                                </td>
                                <td align="right" colspan="1" rowspan="1" valign="top">
                                    <bold>329</bold>
                                </td>
                                <td align="right" colspan="1" rowspan="1" valign="top">
                                    <bold>72</bold>
                                </td>
                                <td align="right" colspan="1" rowspan="1" valign="top">
                                    <bold>21.9</bold>
                                </td>
                                <td align="right" colspan="1" rowspan="1" valign="top">
                                    <bold>71</bold>
                                </td>
                                <td align="right" colspan="1" rowspan="1" valign="top">
                                    <bold>586</bold>
                                </td>
                                <td align="right" colspan="1" rowspan="1" valign="top">
                                    <bold>416</bold>
                                </td>
                                <td align="right" colspan="1" rowspan="1" valign="top">
                                    <bold>71.0</bold>
                                </td>
                            </tr>
                        </tbody>
                    </table>
                </table-wrap>
                <table-wrap id="T4" orientation="portrait" position="anchor">
                    <label>Table 4. </label>
                    <caption>
                        <title>Water container surveys in Tri Nguyen - prevalence of 
                            <italic toggle="yes">Ae. aegypti</italic> immatures and abiotic water parameters in water storage containers in northern, central and southern areas in June 2016.</title>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="center" colspan="1" rowspan="2" valign="top">Area</th>
                                <th align="center" colspan="1" rowspan="2" valign="top"># Houses
                                    <break/> surveyed</th>
                                <th align="center" colspan="1" rowspan="2" valign="top">Container
                                    <break/> type</th>
                                <th align="center" colspan="1" rowspan="2" valign="top">Mean 
                                    <break/>cont. per
                                    <break/> house</th>
                                <th align="center" colspan="1" rowspan="2" valign="top">Number 
                                    <break/>cont. 
                                    <break/>surveyed</th>
                                <th align="center" colspan="1" rowspan="2" valign="top">Number 
                                    <break/>cont. +ve 
                                    <break/>
                                    <italic toggle="yes">Ae. aegypti</italic>
                                </th>
                                <th align="center" colspan="1" rowspan="2" valign="top">% cont.
                                    <break/> +ve 
                                    <italic toggle="yes">Ae. </italic>
                                    <break/>
                                    <italic toggle="yes">aegypti</italic>
                                </th>
                                <th align="center" colspan="3" rowspan="1" valign="top">
                                    <italic toggle="yes">Water parameters</italic>
                                </th>
                            </tr>
                            <tr>
                                <th align="center" colspan="1" rowspan="1" valign="top">pH</th>
                                <th align="center" colspan="1" rowspan="1" valign="top">Salinity
                                    <break/> (ppt)</th>
                                <th align="center" colspan="1" rowspan="1" valign="top">Conductivity</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">North</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">24</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Tanks</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">2.4</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">58</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">6</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">10.3</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">7.93</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">0</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">178</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top">Drums</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">1.2</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">28</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">11</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">39.3</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">7.56</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">0</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">348</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top">Jars</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">1.0</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">24</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">6</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">25.0</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">7.48</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">1.1</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">513</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top">Buckets</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">1.1</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">26</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">7</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">26.9</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">7.16</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">0.1</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">521</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top">Vases</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">0.6</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">14</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">0</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">0</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">5.87</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">0</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">389</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top">Other</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">0.1</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">2</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">0</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">0</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">7.38</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">0</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">733</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <bold>Subtotal</bold>
                                </td>
                                <td align="right" colspan="1" rowspan="1" valign="top">
                                    <bold>6.3</bold>
                                </td>
                                <td align="right" colspan="1" rowspan="1" valign="top">
                                    <bold>152</bold>
                                </td>
                                <td align="right" colspan="1" rowspan="1" valign="top">
                                    <bold>30</bold>
                                </td>
                                <td align="right" colspan="1" rowspan="1" valign="top">
                                    <bold>19.7</bold>
                                </td>
                                <td align="center" colspan="1" rowspan="1" valign="top">
                                    <bold>7.46</bold>
                                </td>
                                <td align="right" colspan="1" rowspan="1" valign="top">
                                    <bold>0.0</bold>
                                </td>
                                <td align="right" colspan="1" rowspan="1" valign="top">
                                    <bold>348</bold>
                                </td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">Center</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">13</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Tanks</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">2.6</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">34</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">3</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">8.8</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">8.20</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">1.1</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">2056</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top">Drums</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">2.6</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">34</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">11</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">32.4</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">7.84</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">1.6</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">2783</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top">Jars</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">0.8</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">10</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">6</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">60.0</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">7.77</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">1.2</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">2418</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top">Buckets</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">2.2</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">28</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">4</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">14.3</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">7.99</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">1.7</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">2928</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top">Vases</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">0.2</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">3</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">0</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">0.0</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">5.87</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">0</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">255</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top">Other</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">0.6</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">8</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">1</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">12.5</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">7.92</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">1.6</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">849</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <bold>Subtotal</bold>
                                </td>
                                <td align="right" colspan="1" rowspan="1" valign="top">
                                    <bold>9.0</bold>
                                </td>
                                <td align="right" colspan="1" rowspan="1" valign="top">
                                    <bold>117</bold>
                                </td>
                                <td align="right" colspan="1" rowspan="1" valign="top">
                                    <bold>25</bold>
                                </td>
                                <td align="right" colspan="1" rowspan="1" valign="top">
                                    <bold>21.4</bold>
                                </td>
                                <td align="center" colspan="1" rowspan="1" valign="top">
                                    <bold>7.93</bold>
                                </td>
                                <td align="right" colspan="1" rowspan="1" valign="top">
                                    <bold>1.4</bold>
                                </td>
                                <td align="right" colspan="1" rowspan="1" valign="top">
                                    <bold>2515</bold>
                                </td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top">South</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">13</td>
                                <td align="left" colspan="1" rowspan="1" valign="top">Tanks</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">1.2</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">16</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">2</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">12.5</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">8.06</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">2.5</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">4150</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top">Drums</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">2.5</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">33</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">9</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">27.3</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">7.99</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">1.7</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">2966</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top">Jars</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">0.8</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">10</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">4</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">40.0</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">8.29</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">2.4</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">4130</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top">Buckets</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">1.7</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">22</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">5</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">22.7</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">7.90</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">2.3</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">4050</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top">Vases</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">0.4</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">5</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">0</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">0</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">7.04</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">1.0</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">1713</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top">Other</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">0.2</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">2</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">0</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">0</td>
                                <td align="center" colspan="1" rowspan="1" valign="top">8.15</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">1.7</td>
                                <td align="right" colspan="1" rowspan="1" valign="top">2887</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top"/>
                                <td align="left" colspan="1" rowspan="1" valign="top">
                                    <bold>Subtotal</bold>
                                </td>
                                <td align="right" colspan="1" rowspan="1" valign="top">
                                    <bold>6.8</bold>
                                </td>
                                <td align="right" colspan="1" rowspan="1" valign="top">
                                    <bold>88</bold>
                                </td>
                                <td align="right" colspan="1" rowspan="1" valign="top">
                                    <bold>20</bold>
                                </td>
                                <td align="right" colspan="1" rowspan="1" valign="top">
                                    <bold>20</bold>
                                </td>
                                <td align="center" colspan="1" rowspan="1" valign="top">
                                    <bold>7.96</bold>
                                </td>
                                <td align="right" colspan="1" rowspan="1" valign="top">
                                    <bold>2.0</bold>
                                </td>
                                <td align="right" colspan="1" rowspan="1" valign="top">
                                    <bold>3512</bold>
                                </td>
                            </tr>
                        </tbody>
                    </table>
                </table-wrap>
            </sec>
            <sec>
                <title>Vinh Luong</title>
                <p>Releases of 
                    <italic toggle="yes">w</italic>Mel 
                    <italic toggle="yes">Wolbachia Ae. aegypti</italic> mosquitoes in Vinh Luong were undertaken weekly for 17 weeks, with an average of 32,733 mosquitoes released per week (range 18,605 to 38,772) (
                    <xref ref-type="fig" rid="f5">Figure 5</xref>). Compared with the Tri Nguyen releases where weekly releases were undertaken outside almost all houses (97.2%), the Vinh Luong releases were undertaken using evenly spaced 50 m x 50 m grids, with a single release inside each grid. This corresponded to a lower per house release density (one release point per nine houses in Vinh Luong, one release point per 1.03 houses in Tri Nguyen) and a lower weekly per house release rate (11.5 mosquitoes per house per week in Vinh Luong, 32.4 mosquitoes per house per week in Tri Nguyen). By the end of 17 weeks of releases (July 2018) the 
                    <italic toggle="yes">Wolbachia</italic> infection prevalence in mosquitoes was 78.9% (
                    <xref ref-type="fig" rid="f7">Figure 7</xref>, 
                    <xref ref-type="fig" rid="f10">Figure 10</xref>). Over the next four months the 
                    <italic toggle="yes">Wolbachia</italic> infection prevalence decreased to a low of 52.0% by October 2018, which coincided with high median weekly temperatures inside houses (29.1&#x2013;32.1&#x00b0;C). The was followed by an increase in 
                    <italic toggle="yes">Wolbachia</italic> infection prevalence to 93.0% by March 2019, which coincided with lower seasonal temperatures (median weekly 25.6&#x2013;29.1&#x00b0;C). Between June and October 2019, the 
                    <italic toggle="yes">Wolbachia</italic> infection prevalence decreased to 41.4%, which coincided with high median weekly temperatures inside houses (29.6&#x2013;32.5&#x00b0;C). Field monitoring was interrupted from January to November 2020 due to social distancing requirements in response to COVID-19. 
                    <italic toggle="yes">Wolbachia</italic> infection prevalence in mosquitoes between November 2020 and March 2021 was high, ranging from 88.1&#x2013;97.2%. (
                    <xref ref-type="fig" rid="f7">Figure 7</xref>, 
                    <xref ref-type="fig" rid="f10">Figure 10</xref>). Similar to Tri Nguyen, temperatures measured inside houses in Vinh Luong were warmer than the Nha Trang City meteorological data, with median temperatures inside houses 1.6 +/- 0.4 (s.d.) &#x00b0;C higher than the mean temperatures in Nha Trang City.</p>
                <fig fig-type="figure" id="f5" orientation="portrait" position="float">
                    <label>Figure 5. </label>
                    <caption>
                        <title>Mean numbers of 
                            <italic toggle="yes">Wolbachia</italic> mosquitoes released per house per week (black bars), and total numbers of 
                            <italic toggle="yes">Wolbachia</italic> mosquitoes released (red circles) in Vinh Luong per week.</title>
                    </caption>
                    <graphic orientation="portrait" position="float" xlink:href="https://gatesopenresearch-files.f1000.com/manuscripts/14782/28024d43-fd50-43c9-ad0e-5c5cf9dd8b7a_figure5.gif"/>
                </fig>
                <fig fig-type="figure" id="f6" orientation="portrait" position="float">
                    <label>Figure 6. </label>
                    <caption>
                        <title>Weather station data for Nha Trang (mean daily maximum temperature per week - dashed red line, mean daily temperature per week - solid black line, mean daily minimum temperature per week - dashed dark blue line, weekly rainfall - light blue bars), household temperature data (median daily temperature per week - gray line, interquartile range - box plots), and 
                            <italic toggle="yes">Wolbachia</italic> infection prevalence in 
                            <italic toggle="yes">Aedes aegypti</italic> mosquitoes in Tri Nguyen (
                            <italic toggle="yes">Wolbachia</italic> prevalence in 
                            <italic toggle="yes">Ae. aegypti</italic> mosquitoes, total positives / total number tested - blue line, median 
                            <italic toggle="yes">Wolbachia</italic> prevalence in mosquitoes per BG trap collection - red line, interquartile range - box plots, no monitoring data between July 2019 and March 2021).</title>
                        <p>Green shading represents 
                            <italic toggle="yes">Wolbachia</italic> mosquito release period (27 weeks).</p>
                    </caption>
                    <graphic orientation="portrait" position="float" xlink:href="https://gatesopenresearch-files.f1000.com/manuscripts/14782/28024d43-fd50-43c9-ad0e-5c5cf9dd8b7a_figure6.gif"/>
                </fig>
                <fig fig-type="figure" id="f7" orientation="portrait" position="float">
                    <label>Figure 7. </label>
                    <caption>
                        <title>Weather station data for Nha Trang (mean daily maximum temperature per week - dashed red line, mean daily temperature per week - solid black line, mean daily minimum temperature per week - dashed dark blue line, weekly rainfall - light blue bars), household temperature data (median daily temperature per week - gray line, interquartile range - box plots), and 
                            <italic toggle="yes">Wolbachia</italic> infection prevalence in 
                            <italic toggle="yes">Aedes aegypti</italic> mosquitoes in Vinh Luong (
                            <italic toggle="yes">Wolbachia</italic> prevalence in 
                            <italic toggle="yes">Ae. aegypti</italic> mosquitoes, total positives / total number tested - blue line, median 
                            <italic toggle="yes">Wolbachia</italic> prevalence in mosquitoes per BG trap collection - red line, interquartile range - box plots, no monitoring data between January 2020 and October 2020).</title>
                        <p>Green shading represents 
                            <italic toggle="yes">Wolbachia</italic> mosquito release period (17 weeks).</p>
                    </caption>
                    <graphic orientation="portrait" position="float" xlink:href="https://gatesopenresearch-files.f1000.com/manuscripts/14782/28024d43-fd50-43c9-ad0e-5c5cf9dd8b7a_figure7.gif"/>
                </fig>
                <fig fig-type="figure" id="f8" orientation="portrait" position="float">
                    <label>Figure 8. </label>
                    <caption>
                        <title>
                            <italic toggle="yes">Wolbachia</italic> frequencies in 
                            <italic toggle="yes">Aedes aegypti</italic> mosquitoes collected in BG Sentinel traps in north, center and south areas in Tri Nguyen (6 November 2014 to 11 June 2018).</title>
                    </caption>
                    <graphic orientation="portrait" position="float" xlink:href="https://gatesopenresearch-files.f1000.com/manuscripts/14782/28024d43-fd50-43c9-ad0e-5c5cf9dd8b7a_figure8.gif"/>
                </fig>
                <fig fig-type="figure" id="f9" orientation="portrait" position="float">
                    <label>Figure 9. </label>
                    <caption>
                        <title>
                            <italic toggle="yes">Wolbachia</italic> frequencies in 
                            <italic toggle="yes">Aedes aegypti</italic> mosquitoes collected in BG Sentinel traps in north, center and south areas in Tri Nguyen (4 December 2018 to 17 April 2021).</title>
                    </caption>
                    <graphic orientation="portrait" position="float" xlink:href="https://gatesopenresearch-files.f1000.com/manuscripts/14782/28024d43-fd50-43c9-ad0e-5c5cf9dd8b7a_figure9.gif"/>
                </fig>
                <fig fig-type="figure" id="f10" orientation="portrait" position="float">
                    <label>Figure 10. </label>
                    <caption>
                        <title>
                            <italic toggle="yes">Wolbachia</italic> frequencies in 
                            <italic toggle="yes">Aedes aegypti</italic> mosquitoes collected in BG Sentinel traps in Vinh Luong (July 2018 to 27 March 2021).</title>
                    </caption>
                    <graphic orientation="portrait" position="float" xlink:href="https://gatesopenresearch-files.f1000.com/manuscripts/14782/28024d43-fd50-43c9-ad0e-5c5cf9dd8b7a_figure10.gif"/>
                </fig>
                <fig fig-type="figure" id="f11" orientation="portrait" position="float">
                    <label>Figure 11. </label>
                    <caption>
                        <title>
                            <italic toggle="yes">Wolbachia</italic> frequency in 
                            <italic toggle="yes">Ae. aegypti</italic> immatures collected from water holding containers in north (27.1%), center (26.9%) and south (71.0%) areas in Tri Nguyen in November 2015.  </title>
                        <p>
                            <italic toggle="yes">Wolbachia</italic> frequency calculated based on pooled samples from all surveyed containers at each house (mean 11, range 1&#x2013;27 surveyed containers per house).</p>
                    </caption>
                    <graphic orientation="portrait" position="float" xlink:href="https://gatesopenresearch-files.f1000.com/manuscripts/14782/28024d43-fd50-43c9-ad0e-5c5cf9dd8b7a_figure11.gif"/>
                </fig>
            </sec>
            <sec>
                <title>Effects of temperature on 
                    <italic toggle="yes">Wolbachia</italic> infection prevalence</title>
                <p>The fluctuations in 
                    <italic toggle="yes">w</italic>Mel 
                    <italic toggle="yes">Wolbachia</italic> infection prevalence in mosquitoes in these two communities in Nha Trang in central Vietnam have consistent seasonal patterns, with reduced 
                    <italic toggle="yes">Wolbachia</italic> infection prevalence in mosquitoes during the hot dry seasons, followed by increased prevalence during the cooler seasons. This is consistent with recent laboratory and semi-field experiments investigating the effects of elevated temperatures on mosquito fitness and the stability of 
                    <italic toggle="yes">Wolbachia</italic> infection in 
                    <italic toggle="yes">Ae. aegypti</italic>. In the laboratory, immature stages (eggs and larvae) that were exposed to diurnal cycling temperatures that ranged from 30&#x2013;40&#x00b0;C had lower 
                    <italic toggle="yes">w</italic>Mel 
                    <italic toggle="yes">Wolbachia</italic> densities in adult mosquitoes sampled at 0&#x2013;2 days of age, compared with control mosquitoes reared at 20&#x2013;30&#x00b0;C, and with partial recovery of 
                    <italic toggle="yes">Wolbachia</italic> levels in mosquitoes by 4&#x2013;7 days of age (
                    <xref ref-type="bibr" rid="ref-50">Ulrich 
                        <italic toggle="yes">et al.</italic>, 2016</xref>). In a second laboratory study, exposure of 
                    <italic toggle="yes">Ae. aegypti</italic> larvae infected with different types of 
                    <italic toggle="yes">Wolbachia</italic> (
                    <italic toggle="yes">w</italic>Mel, 
                    <italic toggle="yes">w</italic>AlbB and 
                    <italic toggle="yes">w</italic>MelPop-CLA) to diurnal cyclical temperatures of 26&#x2013;37&#x00b0;C resulted in reduced egg hatch in 
                    <italic toggle="yes">w</italic>Mel infected eggs, and reduced expression of cytoplasmic incompatibility and 
                    <italic toggle="yes">Wolbachia</italic> density in adult mosquitoes infected with the 
                    <italic toggle="yes">w</italic>Mel and 
                    <italic toggle="yes">w</italic>MelPop-CLA strains, but not the 
                    <italic toggle="yes">w</italic>AlbB strain (
                    <xref ref-type="bibr" rid="ref-26">Ross 
                        <italic toggle="yes">et al.</italic>, 2017</xref>). When immatures and adult females were reared and maintained at diurnal cyclical temperatures of 26&#x2013;37&#x00b0;C, the 
                    <italic toggle="yes">w</italic>Mel and 
                    <italic toggle="yes">w</italic>MelPop-CLA infections were not transmitted to the next generation, which indicated a breakdown in maternal transmission fidelity. In contrast, the 
                    <italic toggle="yes">w</italic>AlbB 
                    <italic toggle="yes">Wolbachia</italic> infected line exhibited only partial breakdown in maternal transmission efficiency (88.5&#x2013;91.7%) (
                    <xref ref-type="bibr" rid="ref-26">Ross 
                        <italic toggle="yes">et al.</italic>, 2017</xref>). Exposure of 
                    <italic toggle="yes">Wolbachia</italic> infected eggs to diurnal cycling temperatures of 30&#x2013;40&#x00b0;C for seven days resulted in lower 
                    <italic toggle="yes">w</italic>Mel and 
                    <italic toggle="yes">w</italic>MelPop densities in adult females and males, compared with adults reared from eggs maintained at a constant 26&#x00b0;C (
                    <xref ref-type="bibr" rid="ref-25">Ross 
                        <italic toggle="yes">et al.</italic>, 2019</xref>). Further laboratory experiments indicated that exposure of larval stages to diurnal fluctuating temperatures between 26&#x2013;37&#x00b0;C resulted in reduced 
                    <italic toggle="yes">Wolbachia</italic> density and starvation tolerance in the following generation, but only in female mosquitoes (
                    <xref ref-type="bibr" rid="ref-5">Foo 
                        <italic toggle="yes">et al.</italic>, 2019</xref>).</p>
                <p>There is only limited previous data on the potential negative effects of temperature on 
                    <italic toggle="yes">Wolbachia</italic> establishment and stability under field conditions. In a semi-field study in northern Australia, 
                    <italic toggle="yes">w</italic>Mel 
                    <italic toggle="yes">Wolbachia</italic>-infected larvae were reared in containers placed in shaded and 50% shaded locations (
                    <xref ref-type="bibr" rid="ref-25">Ross 
                        <italic toggle="yes">et al.</italic>, 2019</xref>). The resulting adult males from the containers placed in 50% shaded locations, which reached temperatures of up to 39&#x00b0;C, were found to have partially lost their ability to induce cytoplasmic compatibility, and females had a greatly reduced egg hatch when crossed to infected males. The only relevant field experiment involving a field population of 
                    <italic toggle="yes">Wolbachia</italic>-infected 
                    <italic toggle="yes">Ae. aegypti</italic> was undertaken in Cairns, Australia, during a heatwave that occurred in November 2018, when temperatures reached 43.6&#x00b0;C (
                    <xref ref-type="bibr" rid="ref-23">Ross 
                        <italic toggle="yes">et al.</italic>, 2020</xref>). Eggs and immature stages (larvae and pupae) and adult mosquitoes were collected from ovitraps, field containers, sentinel containers that were placed in shaded and semi-shaded locations, and BGS sentinel traps throughout the central area of Cairns. In the month following the heatwave, 
                    <italic toggle="yes">Wolbachia</italic> infection prevalence was reduced to 83% in larvae sampled directly from field habitats and 88% in eggs collected from ovitraps, but recovered to be near 100% four months later (
                    <xref ref-type="bibr" rid="ref-23">Ross 
                        <italic toggle="yes">et al.</italic>, 2020</xref>). In this location, where 
                    <italic toggle="yes">Wolbachia</italic> had been established in local mosquito populations for more than five years (
                    <xref ref-type="bibr" rid="ref-46">Ryan 
                        <italic toggle="yes">et al.</italic>, 2020</xref>), high temperatures were found to have only temporary effects on 
                    <italic toggle="yes">Wolbachia</italic> frequencies.</p>
                <p>The effects of elevated temperatures on the 
                    <italic toggle="yes">Wolbachia</italic>-induced viral blocking have been purportedly based on reduced 
                    <italic toggle="yes">Wolbachia</italic> densities in adult mosquitoes exposed to elevated rearing temperatures (
                    <xref ref-type="bibr" rid="ref-26">Ross 
                        <italic toggle="yes">et al.</italic>, 2017</xref>; 
                    <xref ref-type="bibr" rid="ref-25">Ross 
                        <italic toggle="yes">et al.</italic>, 2019</xref>; 
                    <xref ref-type="bibr" rid="ref-23">Ross 
                        <italic toggle="yes">et al.</italic>, 2020</xref>; 
                    <xref ref-type="bibr" rid="ref-50">Ulrich 
                        <italic toggle="yes">et al.</italic>, 2016</xref>); however, there is only limited data showing any direct effects of elevated temperatures on viral blocking. Laboratory experiments indicated that there was no significant effect on dengue 3 virus vector competence of 
                    <italic toggle="yes">w</italic>Mel 
                    <italic toggle="yes">Wolbachia Ae. aegypti</italic> mosquitoes reared at a constant 25&#x00b0;C, then exposed and maintained under two diurnal temperature settings with mean of 25&#x00b0;C and 28&#x00b0;C and a fluctuating range of 8&#x00b0;C (+/- 4 &#x00b0;C) (
                    <xref ref-type="bibr" rid="ref-54">Ye 
                        <italic toggle="yes">et al.</italic>, 2016</xref>). The two diurnal temperature regimes were found to significantly alter 
                    <italic toggle="yes">Wolbachia</italic> density in mosquitoes, with lower 
                    <italic toggle="yes">Wolbachia</italic> densities found in mosquitoes reared at the higher temperature regime; however, there was no association with dengue infection or the extrinsic incubation period of the pathogen in the mosquito (
                    <xref ref-type="bibr" rid="ref-54">Ye 
                        <italic toggle="yes">et al.</italic>, 2016</xref>). In contrast, exposure of 
                    <italic toggle="yes">Ae. aegypti</italic> immatures to higher cyclical temperatures of 28&#x2013;36&#x00b0;C in the laboratory resulted in reduced 
                    <italic toggle="yes">Wolbachia</italic> density and levels of dengue 2 virus blocking in 
                    <italic toggle="yes">w</italic>Mel infected 
                    <italic toggle="yes">Ae. aegypti</italic>, compared with mosquitoes reared at a constant temperature of 27&#x00b0;C (
                    <xref ref-type="bibr" rid="ref-13">Mancini 
                        <italic toggle="yes">et al.</italic>, 2021</xref>). 
                    <italic toggle="yes">w</italic>Mel infected females reared at the higher temperature regime had significantly higher virus infection rates in heads and thoraces (33%) compared to 
                    <italic toggle="yes">w</italic>Mel females reared under constant temperature conditions (4.2%). No significant differences were found in dengue infection rates in 
                    <italic toggle="yes">w</italic>AlbB infected mosquitoes exposed to high-temperature and constant 27&#x00b0;C rearing conditions (
                    <xref ref-type="bibr" rid="ref-13">Mancini 
                        <italic toggle="yes">et al.</italic>, 2021</xref>). One of the few vector competence studies that have utilized field collected 
                    <italic toggle="yes">Wolbachia Ae. aegypti</italic> mosquitoes was undertaken in Tri Nguyen between March 2015 and June 2017 (
                    <xref ref-type="bibr" rid="ref-1">Carrington 
                        <italic toggle="yes">et al.</italic>, 2018</xref>). The dengue virus blocking ability of 
                    <italic toggle="yes">w</italic>Mel-infected 
                    <italic toggle="yes">Ae. aegypti</italic> was compared between laboratory reared wild-type and 
                    <italic toggle="yes">w</italic>Mel-infected 
                    <italic toggle="yes">Ae. aegypti</italic>, and field derived 
                    <italic toggle="yes">w</italic>Mel-infected 
                    <italic toggle="yes">Ae. aegypti</italic> collected from Tri Nguyen village. Compared with wild-type mosquitoes, the relative strength of dengue blocking in 
                    <italic toggle="yes">w</italic>Mel mosquitoes from Tri Nguyen was significantly greater in field-reared mosquitoes (mean reduction 85.9% +/- 6.3 SE) versus laboratory reared mosquitoes (67.9% +/- 5.2 SE, P = 0.033). The majority (30/48, 62.5%) of field collections for these studies were undertaken between March and October 2015, and coincided with fluctuations in 
                    <italic toggle="yes">w</italic>Mel infection prevalence in mosquitoes in the north, central and south areas of 26.9&#x2013;100.0%, 26.0&#x2013;98.0% and 69.9&#x2013;100.0%, respectively. Despite these fluctuations in 
                    <italic toggle="yes">w</italic>Mel infection prevalence and sampling of mosquitoes from containers that were likely to be exposed to relatively high temperatures (median weekly temperatures inside houses ranged from 28.8&#x2013;32.6&#x00b0;C), there was no evidence of any attenuation of virus blocking effects in 
                    <italic toggle="yes">w</italic>Mel infected 
                    <italic toggle="yes">Ae. aegypti</italic> mosquitoes collected from Tri Nguyen village.</p>
                <p>The reduced fidelity in maternal transmission observed in female mosquitoes collected from Tri Nguyen Island in both May 2015 (64.1%) and May 2016 (54.7%) was consistent with the above laboratory studies that show incomplete maternal transmission when immature stages (eggs, larvae, pupae) are exposed to high, fluctuating diurnal temperatures ranging from 26&#x2013;37&#x00b0;C. The high median temperatures measured inside houses in Tri Nguyen village (30.5&#x2013;32.5&#x00b0;C) were probably similar to the temperatures found in the container habitats, and are therefore similar to the mean temperature of 31&#x00b0;C used in the fluctuating diurnal laboratory studies. Despite a complete breakdown in 
                    <italic toggle="yes">Wolbachia</italic> maternal transmission in 
                    <italic toggle="yes">Ae. aegypti</italic> in the laboratory when all life stages were held at 26&#x2013;37&#x00b0;C, maternal transmission rates in Tri Nguyen village remained above 50%. This may reflect the heterogeneity in microclimates in individual containers and the different temperatures that immatures are exposed to. We also note the substantially warmer temperatures inside houses in both Tri Nguyen and Vinh Luong, compared to average temperatures reported from the Nha Trang weather station. These differences in temperatures between those measured inside houses and the weather station data, combined with differences in microclimate data experienced by immatures in different container types, means that caution should be used in drawing conclusions between weather station data and mosquito fitness and 
                    <italic toggle="yes">Wolbachia</italic> infection stability.</p>
                <p>Although we did not measure the temperatures in water containers in the field, our study of maternal transmission in field containers set during the two consecutive hot seasons confirm the loss of 
                    <italic toggle="yes">w</italic>Mel infection in the progeny of 
                    <italic toggle="yes">Wolbachia</italic> infected female mosquitoes. This seasonal loss of 
                    <italic toggle="yes">w</italic>Mel infection in 
                    <italic toggle="yes">Ae. aegypti</italic> mosquitoes may be due to high temperatures in these larval habitats. Several studies have demonstrated that temperatures &gt;35&#x00b0;C significantly reduce 
                    <italic toggle="yes">Wolbachia</italic> infections in 
                    <italic toggle="yes">Ae. aegypti</italic> larvae, especially younger instars (
                    <xref ref-type="bibr" rid="ref-">Ross 
                        <italic toggle="yes">et al.</italic>, 2017</xref>; 
                    <xref ref-type="bibr" rid="ref-">Ross 
                        <italic toggle="yes">et al.</italic>, 2019</xref>; 
                    <xref ref-type="bibr" rid="ref-">Ross 
                        <italic toggle="yes">et al.</italic>, 2020</xref>; 
                    <xref ref-type="bibr" rid="ref-">Ulrich 
                        <italic toggle="yes">et al.</italic>, 2016</xref>). Detailed entomological surveys on Tri Nguyen found that large water storage tanks and jars were responsible for over 90% of larval and pupal production (
                    <xref ref-type="bibr" rid="ref-">Jeffery 
                        <italic toggle="yes">et al.</italic>, 2009</xref>). While temperatures in nearby Nha Trang indicate air temperatures in summer only occasionally exceed 35&#x00b0;C, it is likely that tanks and jars exposed to sunshine would be subject to solar gain and water within them could heat up. Heating of water in containers exposed to even partial sunshine can result in spikes in temperature &gt; 35&#x00b0;C, and concurrent significant loss in 
                    <italic toggle="yes">w</italic>Mel density (
                    <xref ref-type="bibr" rid="ref-">Ross 
                        <italic toggle="yes">et al.</italic>, 2019</xref>). Indeed, the amount of water inside tanks and jars may be at a minimum just when temperatures peak in the late dry season. Water in these tanks may heat well beyond 35&#x00b0;C and cure 
                    <italic toggle="yes">w</italic>Mel infections. Thus, it is critical that seasonal temperatures and 
                    <italic toggle="yes">w</italic>Mel levels in 
                    <italic toggle="yes">Ae. aegypti</italic> be monitored in a range of containers in shade and sunlight during the dry season.</p>
                <p>
                    <italic toggle="yes">Wolbachia</italic> density in 
                    <italic toggle="yes">Ae. aegypti</italic> mosquitoes collected in BGS traps varied seasonally across both Tri Nguyen and Vinh Luong (
                    <xref ref-type="fig" rid="f12">Figure 12</xref>). There was a significant negative correlation between the weekly median 
                    <italic toggle="yes">Wolbachia</italic> density in mosquitoes trapped during the post-release period and the weekly mean daily temperatures measured in households, in each region of Tri Nguyen and in Vinh Luong (
                    <xref ref-type="table" rid="T5">Table 5</xref>). This association was significant for both male and female 
                    <italic toggle="yes">Wolbachia</italic>-infected mosquitoes, but was much more pronounced in females. Associations were strongest when lagged temperature values of up to 5 weeks were included in the model for Tri Nguyen and up to 4 weeks for Vinh Luong.</p>
                <fig fig-type="figure" id="f12" orientation="portrait" position="float">
                    <label>Figure 12. </label>
                    <caption>
                        <title>Median (+/- interquartile range) 
                            <italic toggle="yes">Wolbachia</italic> density in 
                            <italic toggle="yes">Aedes aegypti</italic> mosquitoes collected in BGS traps per week in north, centre and south zones in Tri Nguyen (no monitoring data between July 2019 and March 2021) and in Vinh Luong (no monitoring data between January 2020 and October 2020.</title>
                        <p>Green shading represents 
                            <italic toggle="yes">Wolbachia</italic> mosquito release periods.</p>
                    </caption>
                    <graphic orientation="portrait" position="float" xlink:href="https://gatesopenresearch-files.f1000.com/manuscripts/14782/28024d43-fd50-43c9-ad0e-5c5cf9dd8b7a_figure12.gif"/>
                </fig>
                <table-wrap id="T5" orientation="portrait" position="anchor">
                    <label>Table 5. </label>
                    <caption>
                        <title>Correlation between median 
                            <italic toggle="yes">w</italic>Mel density in weekly collections of 
                            <italic toggle="yes">Ae. aegypti</italic> and the current and lagged mean daily temperature measured in households in Tri Nguyen and Vinh Luong.</title>
                        <p>The coefficient is the linear combination of the regression coefficients (and their 95% confidence intervals) for the current and four prior weekly values of mean daily temperatures, interpretable as the (lagged) change in median relative 
                            <italic toggle="yes">Wolbachia</italic> density associated with a one degree increase in mean daily temperature. Standard errors are adjusted for autocorrelation in 
                            <italic toggle="yes">w</italic>Mel density.</p>
                    </caption>
                    <table content-type="article-table" frame="hsides">
                        <thead>
                            <tr>
                                <th align="left" colspan="1" rowspan="1">Area</th>
                                <th align="left" colspan="1" rowspan="1">Coefficient  (95% CI)</th>
                            </tr>
                        </thead>
                        <tbody>
                            <tr>
                                <td align="left" colspan="1" rowspan="1">Tri Nguyen (North)
                                    <break/>&#x00a0;&#x00a0;&#x00a0;&#x00a0;Females
                                    <break/>&#x00a0;&#x00a0;&#x00a0;&#x00a0;Males</td>
                                <td align="left" colspan="1" rowspan="1">
                                    <break/>-5.18 (-7.16, -3.20)
                                    <break/>-1.24 (-1.79, -0.70)</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1">Tri Nguyen (Center)
                                    <break/>&#x00a0;&#x00a0;&#x00a0;&#x00a0;Females
                                    <break/>&#x00a0;&#x00a0;&#x00a0;&#x00a0;Males</td>
                                <td align="left" colspan="1" rowspan="1">
                                    <break/>-4.26 (-6.30, -2.23)
                                    <break/>-1.21 (-1.86, -0.55)</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1">Tri Nguyen (South)
                                    <break/>&#x00a0;&#x00a0;&#x00a0;&#x00a0;Females
                                    <break/>&#x00a0;&#x00a0;&#x00a0;&#x00a0;Males</td>
                                <td align="left" colspan="1" rowspan="1">
                                    <break/>-3.81 (-5.71, -1.91)
                                    <break/>-1.03 (-1.55, -0.51)</td>
                            </tr>
                            <tr>
                                <td align="left" colspan="1" rowspan="1">Vinh Luong
                                    <break/>&#x00a0;&#x00a0;&#x00a0;&#x00a0;Females
                                    <break/>&#x00a0;&#x00a0;&#x00a0;&#x00a0;Males</td>
                                <td align="left" colspan="1" rowspan="1">
                                    <break/>-2.24 (-2.62, -1.87)
                                    <break/>-0.73 (-0.86, -0.60)</td>
                            </tr>
                        </tbody>
                    </table>
                </table-wrap>
            </sec>
            <sec>
                <title>Other factors affecting 
                    <italic toggle="yes">Wolbachia</italic> infection prevalence</title>
                <p>There was no clear association between 
                    <italic toggle="yes">Wolbachia</italic> establishment in local mosquito populations and seasonal or spatial differences in 
                    <italic toggle="yes">Ae. aegypti</italic> abundance in BGS traps. 
                    <italic toggle="yes">Ae. aegypti</italic> adult mosquito numbers in BGS traps were significantly (P&lt;0.05) higher during the hot season (May to October) compared with the cool season (November to April) across all sites (Tri Nguyen North 
                    <italic toggle="yes">Ae. aegypti</italic> mean catch ratio 1.28 [95% CI 1.18, 1.39]; Center 1.17 [1.07, 1.28]; South 1.42 [1.30, 1.54], Vinh Luong 1.22 [1.22, 1.32]) (
                    <xref ref-type="fig" rid="f13">Figure 13</xref>). In terms of overall mean 
                    <italic toggle="yes">Ae. aegypti</italic> numbers in BGS traps during non-release periods, mosquito densities were significantly higher in Tri Nguyen in the South (Mean catch ratio 1.94 [95%CI 1.26, 2.98]) and Center zones (1.69 [1.16, 2.47]) compared with Vinh Luong; however the numbers in Tri Nguyen North were not significantly different to Vinh Luong (1.18 [0.84, 1.68]). Despite the similar and relatively low mosquito densities in Tri Nguyen in the North and in Vinh Luong, and similar seasonal variations in mosquito densities, 
                    <italic toggle="yes">Wolbachia</italic> persistence was high across Vinh Luong; whereas its persistence was low in the Tri Nguyen North zone. In contrast, the Tri Nguyen South zone had almost twice the mean numbers of 
                    <italic toggle="yes">Ae. aegypti</italic> in BGS traps, compared with Vinh Luong, and 
                    <italic toggle="yes">Wolbachia</italic> persistence was high across both sites. Comparisons of 
                    <italic toggle="yes">Ae. aegypti</italic> numbers in BGS traps before and after releases indicated that 
                    <italic toggle="yes">Ae. aegypti</italic> numbers in Tri Nguyen were higher in the post-release period compared with the pre-release period (Mean catch ratio 1.29 [95% CI 1.18, 1.41]), whereas in Vinh Luong the reverse was observed, with a reduction in numbers during the post-release period (Mean catch ratio 0.87 [95% CI 0.80, 0.96]). Within zone differences in 
                    <italic toggle="yes">Ae. aegypti</italic> numbers before and after releases were found in Tri Nguyen, with significantly higher numbers during the post release periods in the Center and South areas (
                    <italic toggle="yes">Ae. aegypti</italic> mean catch ratios 1.60 [95% CI 1.37, 1.88] and 1.33 [1.15, 1.55], respectively), but not in the North zone (1.04 [0.89, 1.22]). Although these analyses were adjusted for season, they may still be confounded by seasonality as the pre-release monitoring period in both locations was very short (4&#x2013;5 months). Not surprisingly, the mean numbers of 
                    <italic toggle="yes">Ae. aegypti</italic> in BGS traps during the releases were higher than the numbers during non-release periods in both Tri Nguyen (Mean catch ratio 1.82 [95% CI 1.69, 1.96]) and Vinh Luong (1.98 [1.82, 2.15]).</p>
                <fig fig-type="figure" id="f13" orientation="portrait" position="float">
                    <label>Figure 13. </label>
                    <caption>
                        <title>Mean (+/- standard deviation [SD]) numbers of 
                            <italic toggle="yes">Aedes aegypti</italic> mosquitoes collected in BGS traps per week in north, centre and south zones in Tri Nguyen (no monitoring data between July 2019 and March 2021) and in Vinh Luong (no monitoring data between January 2020 and October 2020).</title>
                        <p>Green shading represents 
                            <italic toggle="yes">Wolbachia</italic> mosquito release periods.</p>
                    </caption>
                    <graphic orientation="portrait" position="float" xlink:href="https://gatesopenresearch-files.f1000.com/manuscripts/14782/28024d43-fd50-43c9-ad0e-5c5cf9dd8b7a_figure13.gif"/>
                </fig>
                <p>The small-scale spatial heterogeneity in 
                    <italic toggle="yes">Wolbachia</italic> infection prevalence throughout Tri Nguyen, over distances of 200&#x2013;300 m, suggests that other factors, besides ambient temperature, are important to 
                    <italic toggle="yes">Wolbachia</italic> persistence in this setting. The prevalence of containers was similar across the Tri Nguyen site, and, despite some variation in abiotic water parameters, we found no association between these container characteristics and 
                    <italic toggle="yes">Wolbachia</italic> infection prevalence. The persistence of 
                    <italic toggle="yes">Wolbachia</italic> in mosquito populations in the south area of Tri Nguyen village, for over seven years, may present an opportunity for direct selection of 
                    <italic toggle="yes">Wolbachia</italic> variants with higher thermal tolerance. Although laboratory experiments found limited capacity for 
                    <italic toggle="yes">w</italic>Mel infected 
                    <italic toggle="yes">Ae. aegypti</italic> to adapt to high temperatures (
                    <xref ref-type="bibr" rid="ref-24">Ross &amp; Hoffmann, 2018</xref>), long term monitoring of the Tri Nguyen village site will determine whether 
                    <italic toggle="yes">Wolbachia</italic> can adapt to exposure to high temperatures and other potential environmental factors. The long-term persistence of 
                    <italic toggle="yes">Wolbachia</italic> in Vinh Luong, despite some seasonal fluctuations in 
                    <italic toggle="yes">Wolbachia</italic> infection prevalence, indicates that different underlying factors are associated with 
                    <italic toggle="yes">Wolbachia</italic> maintenance.</p>
                <p>Given the successful establishment and persistence of 
                    <italic toggle="yes">w</italic>Mel 
                    <italic toggle="yes">Wolbachia</italic> in mosquito populations across a range of settings (
                    <xref ref-type="bibr" rid="ref-7">Garcia 
                        <italic toggle="yes">et al.</italic>, 2019</xref>; 
                    <xref ref-type="bibr" rid="ref-8">Gesto 
                        <italic toggle="yes">et al.</italic>, 2021</xref>; 
                    <xref ref-type="bibr" rid="ref-9">Hoffmann 
                        <italic toggle="yes">et al.</italic>, 2011</xref>; 
                    <xref ref-type="bibr" rid="ref-10">Hoffmann 
                        <italic toggle="yes">et al.</italic>, 2014</xref>; 
                    <xref ref-type="bibr" rid="ref-11">Indriani 
                        <italic toggle="yes">et al.</italic>, 2020</xref>; 
                    <xref ref-type="bibr" rid="ref-19">O'Neill 
                        <italic toggle="yes">et al.</italic>, 2019</xref>; 
                    <xref ref-type="bibr" rid="ref-46">Ryan 
                        <italic toggle="yes">et al.</italic>, 2020</xref>; 
                    <xref ref-type="bibr" rid="ref-47">Schmidt 
                        <italic toggle="yes">et al.</italic>, 2017</xref>; 
                    <xref ref-type="bibr" rid="ref-48">Tantowijoyo 
                        <italic toggle="yes">et al</italic>., 2020</xref>; 
                    <xref ref-type="bibr" rid="ref-51">Utarini 
                        <italic toggle="yes">et al.</italic>, 2021</xref>), some of which experience short term fluctuations in temperatures analogous to those experienced in Tri Nguyen village and Vinh Luong, it is clear that ambient measured temperatures alone may be insufficient to predict the success or failure of 
                    <italic toggle="yes">w</italic>Mel deployments. Elements of the built environment, as yet undetermined, may have important effects on 
                    <italic toggle="yes">Wolbachia</italic> establishment and persistence. In some complex urban environments, it may prove slow and operationally challenging to achieve a homogeneous high level of 
                    <italic toggle="yes">Wolbachia</italic> establishment. But it has been demonstrated in Niter&#x00f3;i, Brazil, that measurable reductions in dengue, chikungunya and Zika disease accrue even at a moderate prevalence of 
                    <italic toggle="yes">w</italic>Mel in local 
                    <italic toggle="yes">Ae. aegypti</italic> populations (40% to &gt;80%) (
                    <xref ref-type="bibr" rid="ref-20">Pinto 
                        <italic toggle="yes">et al</italic>., 2021</xref>).</p>
                <p>The potential effects of elevated seasonal temperatures on 
                    <italic toggle="yes">Wolbachia</italic> establishment may become more important in areas with arid and temperate climates that experience wider yearly temperature ranges and higher summer temperatures compared to tropical climates. These arid and temperate climate areas are typically found at latitudes between 20&#x2013;35&#x00b0;north and south. In comparison, areas with tropical climates (particularly tropical rainforest and tropical monsoon climates) are characterized by monthly temperatures above 18&#x00b0;C year-round (typically between 21&#x2013;30&#x00b0;C), and the annual temperature range is normally very small. The global population at risk of dengue in 2015 was estimated to be 3.83 billion (roughly 53% of the global population) (
                    <xref ref-type="bibr" rid="ref-17">Messina 
                        <italic toggle="yes">et al.</italic>, 2019</xref>). Based on 2010 population estimates for various climate zones, approximately 2.2 billion people (58% of at the risk dengue population) reside in areas with tropical climates (
                    <xref ref-type="bibr" rid="ref-3">Center for International Earth Science Information Network, 2012</xref>). For most of these areas the environmental conditions are likely to be less extreme than those experienced in Tri Nguyen and Vinh Luong, and therefore 
                    <italic toggle="yes">w</italic>Mel releases are likely to result in stable establishment. Epidemiological modelling predicted that the establishment of 
                    <italic toggle="yes">w</italic>Mel globally, even with an intermediate efficacy (50% transmission reduction), would reduce global dengue incidence by up to 90% (
                    <xref ref-type="bibr" rid="ref-2">Cattarino 
                        <italic toggle="yes">et al.</italic>, 2020</xref>). If this was targeted in tropical areas where temperatures are amenable for 
                    <italic toggle="yes">w</italic>Mel, this would represent a potential overall reduction in global dengue burden of over 50%. For areas outside of the tropics, where the range of 
                    <italic toggle="yes">Ae. aegypti</italic> extends into areas that experience more extreme summer temperatures, 
                    <italic toggle="yes">Wolbachia</italic> strains that are more heat resistant such as 
                    <italic toggle="yes">w</italic>AlbB may be preferable (
                    <xref ref-type="bibr" rid="ref-26">Ross 
                        <italic toggle="yes">et al</italic>., 2017</xref>; 
                    <xref ref-type="bibr" rid="ref-25">Ross 
                        <italic toggle="yes">et al.</italic>, 2019</xref>). Currently, however, there is limited data on the field performance of the 
                    <italic toggle="yes">w</italic>AlbB strain. Small-scale releases of 
                    <italic toggle="yes">w</italic>AlbB mosquitoes in Malaysia resulted in heterogenous establishment, purported to be due to immigration of uninfected mosquitoes from surrounding areas (
                    <xref ref-type="bibr" rid="ref-81">Nazni 
                        <italic toggle="yes">et al.</italic>, 2019</xref>). However, 
                    <italic toggle="yes">w</italic>AlbB has been associated with negative fitness effects in 
                    <italic toggle="yes">Ae. aegypti</italic>, resulting in reduced fertility in adult females emerging from quiescent eggs exposed to moderate temperatures (20&#x2013;30&#x00b0;C) (
                    <xref ref-type="bibr" rid="ref-82">Lau 
                        <italic toggle="yes">et al.</italic>, 2021</xref>). However, as shown in Tri Nguyen and Vinh Luong with 
                    <italic toggle="yes">w</italic>Mel, subtle fitness effects under different environmental conditions may lead to unknown consequences on 
                    <italic toggle="yes">Wolbachia</italic> spread and maintenance, and therefore it is important to better understand the field dynamics 
                    <italic toggle="yes">Wolbachia</italic> strains across different settings and across seasons.</p>
            </sec>
        </sec>
        <sec>
            <title>Data availability</title>
            <sec>
                <title>Underlying data</title>
                <p>Figshare: VL Mosquito data. 
                    <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.6084/m9.figshare.15070803.v1">https://doi.org/10.6084/m9.figshare.15070803.v1</ext-link> (
                    <xref ref-type="bibr" rid="ref-27">Ryan, 2021a</xref>).</p>
                <p>Figshare: VL Release data. 
                    <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.6084/m9.figshare.15070797.v1">https://doi.org/10.6084/m9.figshare.15070797.v1</ext-link> (
                    <xref ref-type="bibr" rid="ref-28">Ryan, 2021b</xref>).</p>
                <p>Figshare: VL Temperature data - data logger. 
                    <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.6084/m9.figshare.15070794.v1">https://doi.org/10.6084/m9.figshare.15070794.v1</ext-link> (
                    <xref ref-type="bibr" rid="ref-29">Ryan, 2021c</xref>).</p>
                <p>Figshare: VL Temperature data - data logger raw. 
                    <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.6084/m9.figshare.15102129">https://doi.org/10.6084/m9.figshare.15102129</ext-link> (
                    <xref ref-type="bibr" rid="ref-30">Ryan, 2021d</xref>).</p>
                <p>Figshare: TN Mosquito data. 
                    <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.6084/m9.figshare.15070785.v1">https://doi.org/10.6084/m9.figshare.15070785.v1</ext-link> (
                    <xref ref-type="bibr" rid="ref-31">Ryan, 2021e</xref>).</p>
                <p>Figshare: TN Release data. 
                    <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.6084/m9.figshare.15070782.v1">https://doi.org/10.6084/m9.figshare.15070782.v1</ext-link> (
                    <xref ref-type="bibr" rid="ref-32">Ryan, 2021f</xref>).</p>
                <p>Figshare: TN Temperature - data logger. 
                    <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.6084/m9.figshare.15070779.v1">https://doi.org/10.6084/m9.figshare.15070779.v1</ext-link> (
                    <xref ref-type="bibr" rid="ref-33">Ryan, 2021g</xref>).</p>
                <p>Figshare: TN Temperature - data logger raw. 
                    <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.6084/m9.figshare.15102150">https://doi.org/10.6084/m9.figshare.15102150</ext-link> (
                    <xref ref-type="bibr" rid="ref-34">Ryan, 2021h</xref>).</p>
                <p>Figshare: VL Wolbachia colony infection rate. 
                    <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.6084/m9.figshare.15102204.v1">https://doi.org/10.6084/m9.figshare.15102204.v1</ext-link> (
                    <xref ref-type="bibr" rid="ref-35">Ryan, 2021i</xref>).</p>
                <p>Figshare: VL Insecticide resistance. 
                    <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.6084/m9.figshare.15102195.v1">https://doi.org/10.6084/m9.figshare.15102195.v1</ext-link> (
                    <xref ref-type="bibr" rid="ref-36">Ryan, 2021j</xref>).</p>
                <p>Figshare: VL Fecundity and hatch rate. 
                    <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.6084/m9.figshare.15102210.v1">https://doi.org/10.6084/m9.figshare.15102210.v1</ext-link> (
                    <xref ref-type="bibr" rid="ref-37">Ryan, 2021k</xref>).</p>
                <p>Figshare: VL Wolbachia colony maternal transmission. 
                    <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.6084/m9.figshare.15102198.v1">https://doi.org/10.6084/m9.figshare.15102198.v1</ext-link> (
                    <xref ref-type="bibr" rid="ref-38">Ryan, 2021l</xref>).</p>
                <p>Figshare: Field maternal transmission data. 
                    <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.6084/m9.figshare.15102192.v1">https://doi.org/10.6084/m9.figshare.15102192.v1</ext-link> (
                    <xref ref-type="bibr" rid="ref-39">Ryan, 2021m</xref>).</p>
                <p>Figshare: TN Water Quality Survey. 
                    <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.6084/m9.figshare.15102180.v1">https://doi.org/10.6084/m9.figshare.15102180.v1</ext-link> (
                    <xref ref-type="bibr" rid="ref-40">Ryan, 2021n</xref>).</p>
                <p>Figshare: TN Water container surveys wMel prevalence. 
                    <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.6084/m9.figshare.15102186.v1">https://doi.org/10.6084/m9.figshare.15102186.v1</ext-link> (
                    <xref ref-type="bibr" rid="ref-41">Ryan, 2021o</xref>).</p>
                <p>Figshare: VL Cross sectional surveys. 
                    <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.6084/m9.figshare.15102177">https://doi.org/10.6084/m9.figshare.15102177</ext-link> (
                    <xref ref-type="bibr" rid="ref-42">Ryan, 2021p</xref>).</p>
                <p>Ryan, Peter (2021): TN BGS Ae. aegypti Abundance. figshare. Dataset. 
                    <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.6084/m9.figshare.17427434.v1">https://doi.org/10.6084/m9.figshare.17427434.v1</ext-link> </p>
                <p>Ryan, Peter (2021): VL BGS Ae. aegypti Abundance. figshare. Dataset. 
                    <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.6084/m9.figshare.17427470.v1">https://doi.org/10.6084/m9.figshare.17427470.v1</ext-link> </p>
                <p>Ryan, Peter (2021): Wolbachia density data. figshare. Dataset. 
                    <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.6084/m9.figshare.17427479.v1">https://doi.org/10.6084/m9.figshare.17427479.v1</ext-link>
                </p>
            </sec>
            <sec>
                <title>Extended data</title>
                <p>Figshare: VL Communications Materials. 
                    <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.6084/m9.figshare.15185022">https://doi.org/10.6084/m9.figshare.15185022</ext-link> (
                    <xref ref-type="bibr" rid="ref-43">Ryan, 2021q</xref>).</p>
                <p>Figshare: TN Communications Materials. 
                    <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.6084/m9.figshare.15184944">https://doi.org/10.6084/m9.figshare.15184944</ext-link> (
                    <xref ref-type="bibr" rid="ref-44">Ryan, 2021r</xref>).</p>
                <p>Figshare: TN Open Letter. 
                    <ext-link ext-link-type="uri" xlink:href="https://doi.org/10.6084/m9.figshare.15185241">https://doi.org/10.6084/m9.figshare.15185241</ext-link> (
                    <xref ref-type="bibr" rid="ref-45">Ryan, 2021s</xref>).</p>
                <p>Data are available under the terms of the 
                    <ext-link ext-link-type="uri" xlink:href="https://creativecommons.org/licenses/by/4.0/">Creative Commons Attribution 4.0 International license</ext-link> (CC-BY 4.0).</p>
            </sec>
        </sec>
    </body>
    <back>
        <ack>
            <title>Acknowledgements</title>
            <p>We would like to acknowledge the residents of Tri Nguyen and Vinh Luong for their willing participation, including the community collaborators and hamlet leaders in Tri Nguyen and Vinh Luong, particularly the support and assistance of Nguyen D. Trong, Chairman of Vinh Nguyen Ward, Pham T.T. Hang, Vice Chairman of Vinh Luong Ward, Tran X. Thu, Head of the Tri Nguyen Health Station, and Huynh T. Lien, Head of Vinh Luong Health Station.</p>
            <p>We wish to thank Nguyen D. Tai from the Khanh Hoa People's Committee, Nguyen S. Khanh from the Nha Trang People's Committee, and the Khanh Hoa Department of Health, particularly Bui X. Minh, Le H. Quan, Lam Q. Chung, Phu Q. Viet and Luu T. Hieu for their support and assistance.</p>
            <p>We would especially like to acknowledge the many volunteers that willingly provided blood for bloodfeeding of mosquito colonies. We also wish to acknowledge and thank the many dedicated past and present members of the Eliminate Dengue Project (now the World Mosquito Program) who worked on this project, particularly Nguyen V. Soai, Nguyen T.T. Giang and Nguyen V. Anh for their support for laboratory and insectary activities at NIHE, Nguyen H. Binh and Truong Q. Nhu for their support for insectary activities in Nha Trang, and the broad support from Yi Dong, Anita So, Jason Jeffery, Petrina Johnson, Helen Cook, and Shane Fairlie.</p>
        </ack>
        <ref-list>
            <ref id="ref-1">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Carrington</surname>
                            <given-names>LB</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Tran</surname>
                            <given-names>BCN</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Le</surname>
                            <given-names>NTH</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Field- and clinically derived estimates of 
                        <italic toggle="yes">Wolbachia</italic>-mediated blocking of dengue virus transmission potential in 
                        <italic toggle="yes">Aedes aegypti</italic> mosquitoes.</article-title>
                    <source>

                        <italic toggle="yes">Proc Natl Acad Sci U S A.</italic>
</source>
                    <year>2018</year>;<volume>115</volume>(<issue>2</issue>):<fpage>361</fpage>&#x2013;<lpage>366</lpage>.
                    <pub-id pub-id-type="pmid">29279375</pub-id>
                    <pub-id pub-id-type="doi">10.1073/pnas.1715788115</pub-id>
                    <pub-id pub-id-type="pmcid">5777059</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-2">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Cattarino</surname>
                            <given-names>L</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Rodriguez-Barraquer</surname>
                            <given-names>I</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Imai</surname>
                            <given-names>N</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Mapping global variation in dengue transmission intensity.</article-title>
                    <source>

                        <italic toggle="yes">Sci Transl Med.</italic>
</source>
                    <year>2020</year>;<volume>12</volume>(<issue>528</issue>):<fpage>eaax4144</fpage>.
                    <pub-id pub-id-type="pmid">31996463</pub-id>
                    <pub-id pub-id-type="doi">10.1126/scitranslmed.aax4144</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-3">
                <mixed-citation publication-type="journal">
                    <collab>Center for International Earth Science Information Network (CIESIN), Columbia University</collab>:
                    <article-title> National Aggregates of Geospatial Data: Population, Landscape and Climate Estimates Version 3 (PLACE III).</article-title>Palisades, NY: NASA Socioeconomic Data and Applications Center (SEDAC).<year> 2012</year>; Accessed 27 May 2021.
                    <ext-link ext-link-type="uri" xlink:href="http://sedac.ciesin.columbia.edu/data/set/nagdc-population-landscape-climate-estimates-v3">Reference Source</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref-4">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Dar</surname>
                            <given-names>M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Giesler</surname>
                            <given-names>T</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Richardson</surname>
                            <given-names>R</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Development of a novel ozone- and photo-stable HyPer5 red fluorescent dye for array CGH and microarray gene expression analysis with consistent performance irrespective of environmental conditions.</article-title>
                    <source>

                        <italic toggle="yes">BMC Biotechnol.</italic>
</source>
                    <year>2008</year>;<volume>8</volume>:<fpage>86</fpage>.
                    <pub-id pub-id-type="pmid">19014508</pub-id>
                    <pub-id pub-id-type="doi">10.1186/1472-6750-8-86</pub-id>
                    <pub-id pub-id-type="pmcid">2613886</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-5">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Foo</surname>
                            <given-names>IJ</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Hoffmann</surname>
                            <given-names>AA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ross</surname>
                            <given-names>PA</given-names>
                        </name>
</person-group>:
                    <article-title>Cross-generational effects of heat stress on fitness and 
                        <italic toggle="yes">Wolbachia</italic> density in 
                        <italic toggle="yes">Aedes aegypti</italic> mosquitoes.</article-title>
                    <source>

                        <italic toggle="yes">Trop Med Infect Dis.</italic>
</source>
                    <year>2019</year>;<volume>4</volume>(<issue>1</issue>):<fpage>13</fpage>.
                    <pub-id pub-id-type="pmid">30642130</pub-id>
                    <pub-id pub-id-type="doi">10.3390/tropicalmed4010013</pub-id>
                    <pub-id pub-id-type="pmcid">6473245</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-6">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Frentiu</surname>
                            <given-names>FD</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Zakir</surname>
                            <given-names>T</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Walker</surname>
                            <given-names>T</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Limited dengue virus replication in field-collected 
                        <italic toggle="yes">Aedes aegypti</italic> mosquitoes infected with 
                        <italic toggle="yes">Wolbachia</italic>.</article-title>
                    <source>

                        <italic toggle="yes">PLoS Negl Trop Dis.</italic>
</source>
                    <year>2014</year>;<volume>8</volume>(<issue>2</issue>):<fpage>e2688</fpage>.
                    <pub-id pub-id-type="pmid">24587459</pub-id>
                    <pub-id pub-id-type="doi">10.1371/journal.pntd.0002688</pub-id>
                    <pub-id pub-id-type="pmcid">3930499</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-7">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Garcia</surname>
                            <given-names>GA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Sylvestre</surname>
                            <given-names>G</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Aguiar</surname>
                            <given-names>R</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Matching the genetics of released and local 
                        <italic toggle="yes">Aedes aegypti</italic> populations is critical to assure 
                        <italic toggle="yes">Wolbachia</italic> invasion.</article-title>
                    <source>

                        <italic toggle="yes">PLoS Negl Trop Dis.</italic>
</source>
                    <year>2019</year>;<volume>13</volume>(<issue>1</issue>):<fpage>e0007023</fpage>.
                    <pub-id pub-id-type="pmid">30620733</pub-id>
                    <pub-id pub-id-type="doi">10.1371/journal.pntd.0007023</pub-id>
                    <pub-id pub-id-type="pmcid">6338382</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-8">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Gesto</surname>
                            <given-names>JSM</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ribeiro</surname>
                            <given-names>GS</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Rocha</surname>
                            <given-names>MN</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Reduced competence to arboviruses following the sustainable invasion of 
                        <italic toggle="yes">Wolbachia</italic> into native 
                        <italic toggle="yes">Aedes aegypti</italic> from Southeastern Brazil.</article-title>
                    <source>

                        <italic toggle="yes">Sci Rep.</italic>
</source>
                    <year>2021</year>;<volume>11</volume>(<issue>1</issue>):<fpage>10039</fpage>.
                    <pub-id pub-id-type="pmid">33976301</pub-id>
                    <pub-id pub-id-type="doi">10.1038/s41598-021-89409-8</pub-id>
                    <pub-id pub-id-type="pmcid">8113270</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-9">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Hoffmann</surname>
                            <given-names>AA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Montgomery</surname>
                            <given-names>BL</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Popovici</surname>
                            <given-names>J</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Successful establishment of 
                        <italic toggle="yes">Wolbachia</italic> in 
                        <italic toggle="yes">Aedes</italic> populations to suppress dengue transmission.</article-title>
                    <source>

                        <italic toggle="yes">Nature.</italic>
</source>
                    <year>2011</year>;<volume>476</volume>(<issue>7361</issue>):<fpage>454</fpage>&#x2013;<lpage>457</lpage>.
                    <pub-id pub-id-type="pmid">21866160</pub-id>
                    <pub-id pub-id-type="doi">10.1038/nature10356</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-10">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Hoffmann</surname>
                            <given-names>AA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Iturbe-Ormaetxe</surname>
                            <given-names>I</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Callahan</surname>
                            <given-names>AG</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Stability of the 
                        <italic toggle="yes">w</italic>Mel 
                        <italic toggle="yes">Wolbachia</italic> infection following invasion into 
                        <italic toggle="yes">Aedes aegypti</italic> populations.</article-title>
                    <source>

                        <italic toggle="yes">PLoS Negl Trop Dis.</italic>
</source>
                    <year>2014</year>;<volume>8</volume>(<issue>9</issue>):<fpage>e3115</fpage>.
                    <pub-id pub-id-type="pmid">25211492</pub-id>
                    <pub-id pub-id-type="doi">10.1371/journal.pntd.0003115</pub-id>
                    <pub-id pub-id-type="pmcid">4161343</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-11">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Indriani</surname>
                            <given-names>C</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Tantowijoyo</surname>
                            <given-names>W</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ranc&#x00e8;s</surname>
                            <given-names>E</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Reduced dengue incidence following deployments of 
                        <italic toggle="yes">Wolbachia</italic>-infected 
                        <italic toggle="yes">Aedes aegypti</italic> in Yogyakarta, Indonesia: a quasi-experimental trial using controlled interrupted time series analysis [version 1; peer review: 2 approved].</article-title>
                    <source>

                        <italic toggle="yes">Gates Open Res.</italic>
</source>
                    <year>2020</year>;<volume>4</volume>:<fpage>50</fpage>.
                    <pub-id pub-id-type="pmid">32803130</pub-id>
                    <pub-id pub-id-type="doi">10.12688/gatesopenres.13122.1</pub-id>
                    <pub-id pub-id-type="pmcid">7403856</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Jeffery</surname>
                            <given-names>JA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Thi Yen</surname>
                            <given-names>N</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Nam</surname>
                            <given-names>VS</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Characterizing the 
                        <italic toggle="yes">Aedes aegypti</italic> population in a Vietnamese village in preparation for a 
                        <italic toggle="yes">Wolbachia</italic>-based mosquito control strategy to eliminate dengue.</article-title>
                    <source>

                        <italic toggle="yes">PLoS Negl Trop Dis.</italic>
</source>
                    <year>2009</year>;<volume>3</volume>(<issue>11</issue>):<fpage>e552</fpage>.
                    <pub-id pub-id-type="pmid">19956588</pub-id>
                    <pub-id pub-id-type="doi">10.1371/journal.pntd.0000552</pub-id>
                    <pub-id pub-id-type="pmcid">2780318</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-12">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Knox</surname>
                            <given-names>TB</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Yen</surname>
                            <given-names>NT</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Nam</surname>
                            <given-names>VS</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Critical evaluation of quantitative sampling methods for 
                        <italic toggle="yes">Aedes aegypti</italic> (Diptera: Culicidae) immatures in water storage containers in Vietnam.</article-title>
                    <source>

                        <italic toggle="yes">J Med Entomol.</italic>
</source>
                    <year>2007</year>;<volume>44</volume>(<issue>2</issue>):<fpage>192</fpage>&#x2013;<lpage>204</lpage>.
                    <pub-id pub-id-type="pmid">17427686</pub-id>
                    <pub-id pub-id-type="doi">10.1603/0022-2585(2007)44[192:ceoqsm]2.0.co;2</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-82">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Lau</surname>
                            <given-names>MJ</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ross</surname>
                            <given-names>PA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Hoffmann</surname>
                            <given-names>AA</given-names>
                        </name>
</person-group>:
                    <article-title>Infertility and fecundity loss of 
                        <italic toggle="yes">Wolbachia</italic>-infected 
                        <italic toggle="yes">Aedes aegypti</italic> hatched from quiescent eggs is expected to alter invasion dynamics.</article-title>
                    <source>

                        <italic toggle="yes">PLoS Negl Trop Dis.</italic>
</source>
                    <year>2021</year>;<volume>15</volume>(<issue>2</issue>):<fpage>e0009179</fpage>.
                    <pub-id pub-id-type="pmid">33591971</pub-id>
                    <pub-id pub-id-type="doi">10.1371/journal.pntd.0009179</pub-id>
                    <pub-id pub-id-type="pmcid">7909672</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-13">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Mancini</surname>
                            <given-names>MV</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ant</surname>
                            <given-names>TH</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Herd</surname>
                            <given-names>CS</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>High temperature cycles result in maternal transmission and dengue infection differences between 
                        <italic toggle="yes">Wolbachia</italic> strains in 
                        <italic toggle="yes">Aedes aegypti</italic>.</article-title>
                    <source>

                        <italic toggle="yes">mBio.</italic>
</source>
                    <year>2021</year>;<volume>12</volume>(<issue>6</issue>):<fpage>e0025021</fpage>.
                    <pub-id pub-id-type="pmid">34749528</pub-id>
                    <pub-id pub-id-type="doi">10.1128/mBio.00250-21</pub-id>
                    <pub-id pub-id-type="pmcid">8576525</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-14">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>McNaughton</surname>
                            <given-names>D</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Duong</surname>
                            <given-names>TT</given-names>
                        </name>
</person-group>:
                    <article-title>Designing a community engagement framework for a new dengue control method: a case study from central Vietnam.</article-title>
                    <source>

                        <italic toggle="yes">PLoS Negl Trop Dis.</italic>
</source>
                    <year>2014</year>;<volume>8</volume>(<issue>5</issue>):<fpage>e2794</fpage>.
                    <pub-id pub-id-type="pmid">24853391</pub-id>
                    <pub-id pub-id-type="doi">10.1371/journal.pntd.0002794</pub-id>
                    <pub-id pub-id-type="pmcid">4031131</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-15">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Menne</surname>
                            <given-names>MJ</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Durre</surname>
                            <given-names>I</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Koreniewski</surname>
                            <given-names>B</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Global Historical Climatology Network - Daily (GHCN-Daily), Version 3.</article-title>Global hourly (CSV), Station ID 48877099999. NOAA National Climatic Data Center.<year>2012a</year>; Accessed 28 May 2021.
                    <pub-id pub-id-type="doi">10.7289/V5D21VHZ</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-16">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Menne</surname>
                            <given-names>MJ</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Durre</surname>
                            <given-names>I</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Vose</surname>
                            <given-names>RS</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>An Overview of the Global Historical Climatology Network-Daily Database.</article-title>
                    <source>

                        <italic toggle="yes">J Atmos Oceanic Technol.</italic>
</source>
                    <year>2012b</year>;<volume>29</volume>(<issue>7</issue>):<fpage>897</fpage>&#x2013;<lpage>910</lpage>.
                    <pub-id pub-id-type="doi">10.1175/JTECH-D-11-00103.1</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-17">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Messina</surname>
                            <given-names>JP</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Brady</surname>
                            <given-names>OJ</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Golding</surname>
                            <given-names>N</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>The current and future global distribution and population at risk of dengue.</article-title>
                    <source>

                        <italic toggle="yes">Nat Microbiol.</italic>
</source>
                    <year>2019</year>;<volume>4</volume>(<issue>9</issue>):<fpage>1508</fpage>&#x2013;<lpage>1515</lpage>.
                    <pub-id pub-id-type="pmid">31182801</pub-id>
                    <pub-id pub-id-type="doi">10.1038/s41564-019-0476-8</pub-id>
                    <pub-id pub-id-type="pmcid">6784886</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-81">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Nazni</surname>
                            <given-names>WA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Hoffmann</surname>
                            <given-names>AA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>NoorAfizah</surname>
                            <given-names>A</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Establishment of Wolbachia strain wAlbB in Malaysian populations of 
                        <italic toggle="yes">Aedes aegypti</italic> for dengue control.</article-title>
                    <source>

                        <italic toggle="yes">Curr Biol.</italic>
</source>
                    <year>2019</year>;<volume>29</volume>(<issue>24</issue>):<fpage>4241</fpage>&#x2013;<lpage>4248.e5</lpage>.
                    <pub-id pub-id-type="pmid">31761702</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.cub.2019.11.007</pub-id>
                    <pub-id pub-id-type="pmcid">6926472</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-18">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Nguyen</surname>
                            <given-names>TH</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Nguyen</surname>
                            <given-names>HL</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Nguyen</surname>
                            <given-names>TY</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Field evaluation of the establishment potential of 
                        <italic toggle="yes">w</italic>MelPop 
                        <italic toggle="yes">Wolbachia</italic> in Australia and Vietnam for dengue control.</article-title>
                    <source>

                        <italic toggle="yes">Parasit Vectors.</italic>
</source>
                    <year>2015</year>;<volume>8</volume>:<fpage>563</fpage>.
                    <pub-id pub-id-type="pmid">26510523</pub-id>
                    <pub-id pub-id-type="doi">10.1186/s13071-015-1174-x</pub-id>
                    <pub-id pub-id-type="pmcid">4625535</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-19">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>O&#x2019;Neill</surname>
                            <given-names>SL</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ryan</surname>
                            <given-names>PA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Turley</surname>
                            <given-names>AP</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Scaled deployment of 
                        <italic toggle="yes">Wolbachia</italic> to protect the community from dengue and other 
                        <italic toggle="yes">Aedes</italic> transmitted arboviruses [version 3; peer review: 2 approved].</article-title>
                    <source>

                        <italic toggle="yes">Gates Open Res.</italic>
</source>
                    <year>2019</year>;<volume>2</volume>:<fpage>36</fpage>.
                    <pub-id pub-id-type="pmid">30596205</pub-id>
                    <pub-id pub-id-type="doi">10.12688/gatesopenres.12844.3</pub-id>
                    <pub-id pub-id-type="pmcid">6305154</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-20">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Pinto</surname>
                            <given-names>SB</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Riback</surname>
                            <given-names>TIS</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Sylvestre</surname>
                            <given-names>G</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Effectiveness of 
                        <italic toggle="yes">Wolbachia</italic>-infected mosquito deployments in reducing the incidence of dengue and other 
                        <italic toggle="yes">Aedes</italic>-borne diseases in Niter&#x00f3;i, Brazil: A quasi-experimental study.</article-title>
                    <source>

                        <italic toggle="yes">PLoS Negl Trop Dis.</italic>
</source>
                    <year>2021</year>;<volume>15</volume>(<issue>7</issue>):<fpage>0009556</fpage>.
                    <pub-id pub-id-type="pmid">34252106</pub-id>
                    <pub-id pub-id-type="doi">10.1371/journal.pntd.0009556</pub-id>
                    <pub-id pub-id-type="pmcid">8297942</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-21">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Quyen</surname>
                            <given-names>DL</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Thanh Le</surname>
                            <given-names>N</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Van Anh</surname>
                            <given-names>CT</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Epidemiological, serological, and virological features of dengue in Nha Trang City, Vietnam.</article-title>
                    <source>

                        <italic toggle="yes">Am J Trop Med Hyg.</italic>
</source>
                    <year>2018</year>;<volume>98</volume>(<issue>2</issue>):<fpage>402</fpage>&#x2013;<lpage>409</lpage>.
                    <pub-id pub-id-type="pmid">29313471</pub-id>
                    <pub-id pub-id-type="doi">10.4269/ajtmh.17-0630</pub-id>
                    <pub-id pub-id-type="pmcid">5929208</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-22">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ritchie</surname>
                            <given-names>SA</given-names>
                        </name>
</person-group>:
                    <article-title>Effect of some animal feeds and oviposition substrates on 
                        <italic toggle="yes">Aedes</italic> oviposition in ovitraps in Cairns, Australia.</article-title>
                    <source>

                        <italic toggle="yes">J Am Mosq Control Assoc.</italic>
</source>
                    <year>2001</year>;<volume>17</volume>(<issue>3</issue>):<fpage>206</fpage>&#x2013;<lpage>208</lpage>.
                    <pub-id pub-id-type="pmid">14529089</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-23">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ross</surname>
                            <given-names>PA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Axford</surname>
                            <given-names>JK</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Yang</surname>
                            <given-names>Q</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Heatwaves cause fluctuations in 
                        <italic toggle="yes">w</italic>Mel 
                        <italic toggle="yes">Wolbachia</italic> densities and frequencies in 
                        <italic toggle="yes">Aedes aegypti</italic>.</article-title>
                    <source>

                        <italic toggle="yes">PLoS Negl Trop Dis.</italic>
</source>
                    <year>2020</year>;<volume>14</volume>(<issue>1</issue>):<fpage>e0007958</fpage>.
                    <pub-id pub-id-type="pmid">31971938</pub-id>
                    <pub-id pub-id-type="doi">10.1371/journal.pntd.0007958</pub-id>
                    <pub-id pub-id-type="pmcid">6977724</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-24">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ross</surname>
                            <given-names>PA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Hoffmann</surname>
                            <given-names>AA</given-names>
                        </name>
</person-group>:
                    <article-title>Continued susceptibility of the 
                        <italic toggle="yes">w</italic>Mel 
                        <italic toggle="yes">Wolbachia</italic> infection in 
                        <italic toggle="yes">Aedes aegypti</italic> to heat stress following field deployment and selection.</article-title>
                    <source>

                        <italic toggle="yes">Insects.</italic>
</source>
                    <year>2018</year>;<volume>9</volume>(<issue>3</issue>):<fpage>78</fpage>.
                    <pub-id pub-id-type="pmid">29966368</pub-id>
                    <pub-id pub-id-type="doi">10.3390/insects9030078</pub-id>
                    <pub-id pub-id-type="pmcid">6165456</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-25">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ross</surname>
                            <given-names>PA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ritchie</surname>
                            <given-names>SA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Axford</surname>
                            <given-names>JK</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Loss of cytoplasmic incompatibility in 
                        <italic toggle="yes">Wolbachia</italic>-infected 
                        <italic toggle="yes">Aedes aegypti</italic> under field conditions.</article-title>
                    <source>

                        <italic toggle="yes">PLoS Negl Trop Dis.</italic>
</source>
                    <year>2019</year>;<volume>13</volume>(<issue>4</issue>):<fpage>e0007357</fpage>.
                    <pub-id pub-id-type="pmid">31002720</pub-id>
                    <pub-id pub-id-type="doi">10.1371/journal.pntd.0007357</pub-id>
                    <pub-id pub-id-type="pmcid">6493766</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-26">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ross</surname>
                            <given-names>PA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Wiwantanaratanabutr</surname>
                            <given-names>I</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Axford</surname>
                            <given-names>JK</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>
                        <italic toggle="yes">Wolbachia</italic> infections in 
                        <italic toggle="yes">Aedes aegypti</italic> differ markedly in their response to cyclical heat stress.</article-title>
                    <source>

                        <italic toggle="yes">PLoS Pathog.</italic>
</source>
                    <year>2017</year>;<volume>13</volume>(<issue>1</issue>):<fpage>e1006006</fpage>.
                    <pub-id pub-id-type="pmid">28056065</pub-id>
                    <pub-id pub-id-type="doi">10.1371/journal.ppat.1006006 </pub-id>
                    <pub-id pub-id-type="pmcid">5215852</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-27">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ryan</surname>
                            <given-names>P</given-names>
                        </name>
</person-group>:
                    <article-title>VL Mosquito data.</article-title>
                    <source>

                        <italic toggle="yes">figshare.</italic>
</source>Dataset.<year> 2021a</year>.
                    <ext-link ext-link-type="uri" xlink:href="http://www.doi.org/10.6084/m9.figshare.15070803.v1">http://www.doi.org/10.6084/m9.figshare.15070803.v1</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref-28">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ryan</surname>
                            <given-names>P</given-names>
                        </name>
</person-group>:
                    <article-title>VL Release data.</article-title>
                    <source>

                        <italic toggle="yes">figshare.</italic>
</source>Dataset.<year> 2021b</year>.
                    <ext-link ext-link-type="uri" xlink:href="http://www.doi.org/10.6084/m9.figshare.15070797.v1">http://www.doi.org/10.6084/m9.figshare.15070797.v1</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref-29">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ryan</surname>
                            <given-names>P</given-names>
                        </name>
</person-group>:
                    <article-title>VL Temperature data - data logger.</article-title>
                    <source>

                        <italic toggle="yes">figshare.</italic>
</source>Dataset.<year> 2021c</year>.
                    <ext-link ext-link-type="uri" xlink:href="http://www.doi.org/10.6084/m9.figshare.15070794.v1">http://www.doi.org/10.6084/m9.figshare.15070794.v1</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref-30">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ryan</surname>
                            <given-names>P</given-names>
                        </name>
</person-group>:
                    <article-title>VL Temperature data - data logger raw.</article-title>
                    <source>

                        <italic toggle="yes">figshare.</italic>
</source>Dataset.<year>2021d</year>.
                    <ext-link ext-link-type="uri" xlink:href="http://www.doi.org/10.6084/m9.figshare.15102129">http://www.doi.org/10.6084/m9.figshare.15102129</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref-31">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ryan</surname>
                            <given-names>P</given-names>
                        </name>
</person-group>:
                    <article-title>TN Mosquito data.</article-title>
                    <source>

                        <italic toggle="yes">figshare.</italic>
</source>Dataset.<year>2021e</year>.
                    <ext-link ext-link-type="uri" xlink:href="http://www.doi.org/10.6084/m9.figshare.15070785.v1">http://www.doi.org/10.6084/m9.figshare.15070785.v1</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref-32">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ryan</surname>
                            <given-names>P</given-names>
                        </name>
</person-group>:
                    <article-title>TN Release data.</article-title>
                    <source>

                        <italic toggle="yes">figshare.</italic>
</source>Dataset.<year>2021f</year>.
                    <ext-link ext-link-type="uri" xlink:href="http://www.doi.org/10.6084/m9.figshare.15070782.v1">http://www.doi.org/10.6084/m9.figshare.15070782.v1</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref-33">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ryan</surname>
                            <given-names>P</given-names>
                        </name>
</person-group>:
                    <article-title>TN Temperature - data logger.</article-title>
                    <source>

                        <italic toggle="yes">figshare.</italic>
</source>Dataset.<year>2021g</year>.
                    <ext-link ext-link-type="uri" xlink:href="http://www.doi.org/10.6084/m9.figshare.15070779.v1">http://www.doi.org/10.6084/m9.figshare.15070779.v1</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref-34">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ryan</surname>
                            <given-names>P</given-names>
                        </name>
</person-group>:
                    <article-title>TN Temperature - data logger raw.</article-title>
                    <source>

                        <italic toggle="yes">figshare.</italic>
</source>Dataset.<year>2021h</year>.
                    <ext-link ext-link-type="uri" xlink:href="http://www.doi.org/10.6084/m9.figshare.15102150">http://www.doi.org/10.6084/m9.figshare.15102150</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref-35">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ryan</surname>
                            <given-names>P</given-names>
                        </name>
</person-group>:
                    <article-title>VL Wolbachia colony infection rate.</article-title>
                    <source>

                        <italic toggle="yes">figshare.</italic>
</source>Dataset.<year>2021i</year>.
                    <ext-link ext-link-type="uri" xlink:href="http://www.doi.org/10.6084/m9.figshare.15102204.v1">http://www.doi.org/10.6084/m9.figshare.15102204.v1</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref-36">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ryan</surname>
                            <given-names>P</given-names>
                        </name>
</person-group>:
                    <article-title>VL Insecticide resistance.</article-title>
                    <source>

                        <italic toggle="yes">figshare.</italic>
</source>Dataset.<year>2021j</year>.
                    <ext-link ext-link-type="uri" xlink:href="http://www.doi.org/10.6084/m9.figshare.15102195.v1">http://www.doi.org/10.6084/m9.figshare.15102195.v1</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref-37">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ryan</surname>
                            <given-names>P</given-names>
                        </name>
</person-group>:
                    <article-title>VL Fecundity and hatch rate.</article-title>
                    <source>

                        <italic toggle="yes">figshare.</italic>
</source>Dataset.<year>2021k</year>.
                    <ext-link ext-link-type="uri" xlink:href="http://www.doi.org/10.6084/m9.figshare.15102210.v1">http://www.doi.org/10.6084/m9.figshare.15102210.v1</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref-38">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ryan</surname>
                            <given-names>P</given-names>
                        </name>
</person-group>:
                    <article-title>VL Wolbachia colony maternal transmission.</article-title>
                    <source>

                        <italic toggle="yes">figshare.</italic>
</source>Dataset.<year>2021l</year>.
                    <ext-link ext-link-type="uri" xlink:href="http://www.doi.org/10.6084/m9.figshare.15102198.v1">http://www.doi.org/10.6084/m9.figshare.15102198.v1</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref-39">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ryan</surname>
                            <given-names>P</given-names>
                        </name>
</person-group>:
                    <article-title>Field maternal transmission data.</article-title>
                    <source>

                        <italic toggle="yes">figshare.</italic>
</source>Media.<year>2021m</year>.
                    <ext-link ext-link-type="uri" xlink:href="http://www.doi.org/10.6084/m9.figshare.15102192.v1">http://www.doi.org/10.6084/m9.figshare.15102192.v1</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref-40">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ryan</surname>
                            <given-names>P</given-names>
                        </name>
</person-group>:
                    <article-title>TN Water Quality Survey.</article-title>
                    <source>

                        <italic toggle="yes">figshare.</italic>
</source>Dataset.<year>2021n</year>.
                    <ext-link ext-link-type="uri" xlink:href="http://www.doi.org/10.6084/m9.figshare.15102180.v1">http://www.doi.org/10.6084/m9.figshare.15102180.v1</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref-41">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ryan</surname>
                            <given-names>P</given-names>
                        </name>
</person-group>:
                    <article-title>TN Water container surveys wMel prevalence.</article-title>
                    <source>

                        <italic toggle="yes">figshare.</italic>
</source>Dataset.<year>2021o</year>.
                    <ext-link ext-link-type="uri" xlink:href="http://www.doi.org/10.6084/m9.figshare.15102186.v1">http://www.doi.org/10.6084/m9.figshare.15102186.v1</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref-42">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ryan</surname>
                            <given-names>P</given-names>
                        </name>
</person-group>:
                    <article-title>VL Cross sectional surveys.</article-title>
                    <source>

                        <italic toggle="yes">figshare.</italic>
</source>Dataset.<year>2021p</year>.
                    <ext-link ext-link-type="uri" xlink:href="http://www.doi.org/10.6084/m9.figshare.15102177">http://www.doi.org/10.6084/m9.figshare.15102177</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref-43">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ryan</surname>
                            <given-names>P</given-names>
                        </name>
</person-group>:
                    <article-title>VL Communications Materials.</article-title>
                    <source>

                        <italic toggle="yes">figshare.</italic>
</source>Poster.<year>2021q</year>.
                    <ext-link ext-link-type="uri" xlink:href="http://www.doi.org/10.6084/m9.figshare.15185022">http://www.doi.org/10.6084/m9.figshare.15185022</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref-44">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ryan</surname>
                            <given-names>P</given-names>
                        </name>
</person-group>:
                    <article-title>TN Communications Materials.</article-title>
                    <source>

                        <italic toggle="yes">figshare.</italic>
</source>Poster.<year>2021r</year>.
                    <ext-link ext-link-type="uri" xlink:href="http://www.doi.org/10.6084/m9.figshare.15184944">http://www.doi.org/10.6084/m9.figshare.15184944</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref-45">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ryan</surname>
                            <given-names>P</given-names>
                        </name>
</person-group>:
                    <article-title>TN Open Letter.</article-title>
                    <source>

                        <italic toggle="yes">figshare.</italic>
</source>Poster.<year>2021s</year>.
                    <ext-link ext-link-type="uri" xlink:href="http://www.doi.org/10.6084/m9.figshare.15185241">http://www.doi.org/10.6084/m9.figshare.15185241</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref-46">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ryan</surname>
                            <given-names>PA</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Turley</surname>
                            <given-names>AP</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Wilson</surname>
                            <given-names>G</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Establishment of 
                        <italic toggle="yes">w</italic>Mel 
                        <italic toggle="yes">Wolbachia</italic> in 
                        <italic toggle="yes">Aedes aegypti</italic> mosquitoes and reduction of local dengue transmission in Cairns and surrounding locations in northern Queensland, Australia [version 2; peer review: 2 Approved].</article-title>
                    <source>

                        <italic toggle="yes">Gates Open Res.</italic>
</source>
                    <year>2020</year>;<volume>3</volume>:<fpage>1547</fpage>.
                    <pub-id pub-id-type="pmid">31667465</pub-id>
                    <pub-id pub-id-type="doi">10.12688/gatesopenres.13061.2</pub-id>
                    <pub-id pub-id-type="pmcid">6801363</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-47">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Schmidt</surname>
                            <given-names>TL</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Barton</surname>
                            <given-names>NH</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ra&#x0161;ic</surname>
                            <given-names>G</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Local introduction and heterogeneous spatial spread of dengue-suppressing 
                        <italic toggle="yes">Wolbachia</italic> through an urban population of 
                        <italic toggle="yes">Aedes aegypti</italic>.</article-title>
                    <source>

                        <italic toggle="yes">PLoS Biol.</italic>
</source>
                    <year>2017</year>;<volume>15</volume>(<issue>5</issue>):<fpage>e2001894</fpage>.
                    <pub-id pub-id-type="pmid">28557993</pub-id>
                    <pub-id pub-id-type="doi">10.1371/journal.pbio.2001894</pub-id>
                    <pub-id pub-id-type="pmcid">5448718</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-48">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Tantowijoyo</surname>
                            <given-names>W</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Andari</surname>
                            <given-names>B</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Arguni</surname>
                            <given-names>E</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Stable 
                        <italic toggle="yes">establishment</italic> of 
                        <italic toggle="yes">w</italic>Mel 
                        <italic toggle="yes">Wolbachia</italic> in 
                        <italic toggle="yes">Aedes aegypti</italic> populations in Yogyakarta, Indonesia.</article-title>
                    <source>

                        <italic toggle="yes">PLoS Negl Trop Dis.</italic>
</source>
                    <year>2020</year>;<volume>14</volume>(<issue>4</issue>):<fpage>e0008157</fpage>.
                    <pub-id pub-id-type="pmid">32302295</pub-id>
                    <pub-id pub-id-type="doi">10.1371/journal.pntd.0008157</pub-id>
                    <pub-id pub-id-type="pmcid">7190183</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-49">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Turelli</surname>
                            <given-names>M</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Barton</surname>
                            <given-names>NH</given-names>
                        </name>
</person-group>:
                    <article-title>Deploying dengue-suppressing 
                        <italic toggle="yes">Wolbachia</italic> : Robust models predict slow but effective spatial spread in 
                        <italic toggle="yes">Aedes aegypti</italic>.</article-title>
                    <source>

                        <italic toggle="yes">Theor Popul Biol.</italic>
</source>
                    <year>2017</year>;<volume>115</volume>:<fpage>45</fpage>&#x2013;<lpage>60</lpage>.
                    <pub-id pub-id-type="pmid">28411063</pub-id>
                    <pub-id pub-id-type="doi">10.1016/j.tpb.2017.03.003</pub-id>
                    <pub-id pub-id-type="pmcid">5476474</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-50">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ulrich</surname>
                            <given-names>JN</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Beier</surname>
                            <given-names>JC</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Devine</surname>
                            <given-names>GJ</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Heat sensitivity of 
                        <italic toggle="yes">w</italic>Mel 
                        <italic toggle="yes">Wolbachia</italic> during 
                        <italic toggle="yes">Aedes aegypti</italic> development.</article-title>
                    <source>

                        <italic toggle="yes">PLoS Negl Trop Dis.</italic>
</source>
                    <year>2016</year>;<volume>10</volume>(<issue>7</issue>):<fpage>e0004873</fpage>.
                    <pub-id pub-id-type="pmid">27459519</pub-id>
                    <pub-id pub-id-type="doi">10.1371/journal.pntd.0004873</pub-id>
                    <pub-id pub-id-type="pmcid">4961373</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-51">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Utarini</surname>
                            <given-names>AU</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Indriani</surname>
                            <given-names>C</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Ahmad</surname>
                            <given-names>RA</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Efficacy of 
                        <italic toggle="yes">Wolbachia</italic>-infected mosquito deployments for the control of dengue.</article-title>
                    <source>

                        <italic toggle="yes">N Engl J Med.</italic>
</source>
                    <year>2021</year>;<volume>384</volume>(<issue>23</issue>):<fpage>2177</fpage>&#x2013;<lpage>2186</lpage>.
                    <pub-id pub-id-type="pmid">34107180</pub-id>
                    <pub-id pub-id-type="doi">10.1056/NEJMoa2030243</pub-id>
                    <pub-id pub-id-type="pmcid">8103655</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-52">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Walker</surname>
                            <given-names>T</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Johnson</surname>
                            <given-names>PH</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Moreira</surname>
                            <given-names>LA</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>The 
                        <italic toggle="yes">w</italic>Mel 
                        <italic toggle="yes">Wolbachia</italic> strain blocks dengue and invades caged 
                        <italic toggle="yes">Aedes aegypti</italic> populations.</article-title>
                    <source>

                        <italic toggle="yes">Nature.</italic>
</source>
                    <year>2011</year>;<volume>476</volume>(<issue>7361</issue>):<fpage>450</fpage>&#x2013;<lpage>3</lpage>.
                    <pub-id pub-id-type="pmid">21866159</pub-id>
                    <pub-id pub-id-type="doi">10.1038/nature10355</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-53">
                <mixed-citation publication-type="journal">
                    <collab>WHO (World Health organization)</collab>:
                    <article-title>Test procedures for insecticide resistance monitoring in malaria vector mosquitoes</article-title>. Geneva,<year>2013</year>.
                    <ext-link ext-link-type="uri" xlink:href="http://www.africairs.net/wp-content/uploads/2012/08/Test-procedures-for-insecticide-resistance-monitoring-WHO.pdf">Reference Source</ext-link>
                </mixed-citation>
            </ref>
            <ref id="ref-54">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Ye</surname>
                            <given-names>YH</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Carrasco</surname>
                            <given-names>AM</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Dong</surname>
                            <given-names>Y</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>The effect of temperature on 
                        <italic toggle="yes">Wolbachia</italic>-mediated dengue virus blocking in 
                        <italic toggle="yes">Aedes aegypti</italic>.</article-title>
                    <source>

                        <italic toggle="yes">Am J Trop Med Hyg.</italic>
</source>
                    <year>2016</year>;<volume>94</volume>(<issue>4</issue>):<fpage>812</fpage>&#x2013;<lpage>819</lpage>.
                    <pub-id pub-id-type="pmid">26856916</pub-id>
                    <pub-id pub-id-type="doi">10.4269/ajtmh.15-0801</pub-id>
                    <pub-id pub-id-type="pmcid">4824223</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-55">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Yeap</surname>
                            <given-names>HL</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Axford</surname>
                            <given-names>JK</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Popovici</surname>
                            <given-names>J</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Assessing quality of life-shortening 
                        <italic toggle="yes">Wolbachia</italic>-infected 
                        <italic toggle="yes">Aedes aegypti</italic> mosquitoes in the field based on capture rates and morphometric assessments.</article-title>
                    <source>

                        <italic toggle="yes"> Parasit Vectors.</italic>
</source>
                    <year>2014</year>;<volume>7</volume>:<fpage>58</fpage>.
                    <pub-id pub-id-type="pmid">24495395</pub-id>
                    <pub-id pub-id-type="doi">10.1186/1756-3305-7-58</pub-id>
                    <pub-id pub-id-type="pmcid">4015819</pub-id>
                </mixed-citation>
            </ref>
            <ref id="ref-80">
                <mixed-citation publication-type="journal">
                    <person-group person-group-type="author">

                        <name name-style="western">
                            <surname>Yeap</surname>
                            <given-names>HL</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Mee</surname>
                            <given-names>P</given-names>
                        </name>

                        <name name-style="western">
                            <surname>Walker</surname>
                            <given-names>T</given-names>
                        </name>

                        <etal/>
</person-group>:
                    <article-title>Dynamics of the "popcorn" Wolbachia infection in outbred 
                        <italic toggle="yes">Aedes aegypti</italic> informs prospects for mosquito vector control.</article-title>
                    <source>

                        <italic toggle="yes">Genetics.</italic>
</source>
                    <year>2011</year>;<volume>187</volume>(<issue>2</issue>):<fpage>583</fpage>&#x2013;<lpage>95</lpage>.
                    <pub-id pub-id-type="pmid">21135075</pub-id>
                    <pub-id pub-id-type="doi">10.1534/genetics.110.122390</pub-id>
                    <pub-id pub-id-type="pmcid">3030498</pub-id>
                </mixed-citation>
            </ref>
        </ref-list>
    </back>
    <sub-article article-type="reviewer-report" id="report31918">
        <front-stub>
            <article-id pub-id-type="doi">10.21956/gatesopenres.14782.r31918</article-id>
            <title-group>
                <article-title>Reviewer response for version 2</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Vazquez-Prokopec</surname>
                        <given-names>Gonzalo M.</given-names>
                    </name>
                    <xref ref-type="aff" rid="r31918a1">1</xref>
                    <role>Referee</role>
                    <uri content-type="orcid">https://orcid.org/0000-0002-0710-270X</uri>
                </contrib>
                <aff id="r31918a1">
                    <label>1</label>Department of Environmental Sciences, Emory University, Atlanta, GA, USA</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>12</day>
                <month>5</month>
                <year>2022</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2022 Vazquez-Prokopec GM</copyright-statement>
                <copyright-year>2022</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport31918" related-article-type="peer-reviewed-article" xlink:href="10.12688/gatesopenres.13347.2"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>All my comments were addressed.</p>
            <p>Is the work clearly and accurately presented and does it cite the current literature?</p>
            <p>Yes</p>
            <p>If applicable, is the statistical analysis and its interpretation appropriate?</p>
            <p>Yes</p>
            <p>Are all the source data underlying the results available to ensure full reproducibility?</p>
            <p>Yes</p>
            <p>Is the study design appropriate and is the work technically sound?</p>
            <p>Yes</p>
            <p>Are the conclusions drawn adequately supported by the results?</p>
            <p>Yes</p>
            <p>Are sufficient details of methods and analysis provided to allow replication by others?</p>
            <p>Yes</p>
            <p>Reviewer Expertise:</p>
            <p>Vector Ecology and Control</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.</p>
        </body>
    </sub-article>
    <sub-article article-type="reviewer-report" id="report31211">
        <front-stub>
            <article-id pub-id-type="doi">10.21956/gatesopenres.14590.r31211</article-id>
            <title-group>
                <article-title>Reviewer response for version 1</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Vazquez-Prokopec</surname>
                        <given-names>Gonzalo M.</given-names>
                    </name>
                    <xref ref-type="aff" rid="r31211a1">1</xref>
                    <role>Referee</role>
                    <uri content-type="orcid">https://orcid.org/0000-0002-0710-270X</uri>
                </contrib>
                <aff id="r31211a1">
                    <label>1</label>Department of Environmental Sciences, Emory University, Atlanta, GA, USA</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>18</day>
                <month>11</month>
                <year>2021</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2021 Vazquez-Prokopec GM</copyright-statement>
                <copyright-year>2021</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport31211" related-article-type="peer-reviewed-article" xlink:href="10.12688/gatesopenres.13347.1"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve-with-reservations</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>There is mounting evidence showing that temperature and possibly other environmental and ecological conditions impact 
                <italic>Wolbachia</italic> maternal transmission in transinfected 
                <italic>Aedes aegypti</italic>. This study reports the findings from a large release of 
                <italic>Ae. aegypti</italic> transinfected with the WMel strain of 
                <italic>Wolbachia</italic> in Vietnam. In general, the manuscript is well written and provides important information regarding the limitations of 
                <italic>Wolbachia</italic> population replacement in tropical urban environments.</p>
            <p> </p>
            <p> General comments: 
                <list list-type="order">
                    <list-item>
                        <p>While I agree that 
                            <italic>Wolbachia</italic> infection may be influenced by temperature, the study failed to demonstrate that temperature was the reason why 
                            <italic>Wolbachia</italic> prevalence was reduced and fragmented in each city. Given the warm season is also associated with high vector abundance, how are the authors certain that there was no effect of immigration of mosquitoes from neighboring areas, not receiving the intervention? Could it be that both immigration and temperature operated in this specific context?</p>
                    </list-item>
                    <list-item>
                        <p>While temperature effects on WMel are documented from the lab, this study did not conduct any experimental quantification of the role of temperature on WMel infection in the field. Again, it is speculative to assume temperature was the only cause.</p>
                    </list-item>
                    <list-item>
                        <p>While there is evidence of WMel infection presence, how about WMel density? Why are not loads of WMel in mosquitoes reported as in other WMP studies?</p>
                    </list-item>
                </list> </p>
            <p> Minor comments: 
                <list list-type="order">
                    <list-item>
                        <p>The figures show mean numbers of mosquitoes but exclude the variability around the mean. Report standard errors or other measure.</p>
                    </list-item>
                </list> </p>
            <p>Is the work clearly and accurately presented and does it cite the current literature?</p>
            <p>Yes</p>
            <p>If applicable, is the statistical analysis and its interpretation appropriate?</p>
            <p>Yes</p>
            <p>Are all the source data underlying the results available to ensure full reproducibility?</p>
            <p>Yes</p>
            <p>Is the study design appropriate and is the work technically sound?</p>
            <p>Yes</p>
            <p>Are the conclusions drawn adequately supported by the results?</p>
            <p>Yes</p>
            <p>Are sufficient details of methods and analysis provided to allow replication by others?</p>
            <p>Yes</p>
            <p>Reviewer Expertise:</p>
            <p>Vector Ecology and Control</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.</p>
        </body>
        <sub-article article-type="response" id="comment3492-31211">
            <front-stub>
                <contrib-group>
                    <contrib contrib-type="author">
                        <name>
                            <surname>Ryan</surname>
                            <given-names>Peter</given-names>
                        </name>
                        <aff>World Mosquito Program, Vietnam</aff>
                    </contrib>
                </contrib-group>
                <author-notes>
                    <fn fn-type="conflict">
                        <p>
                            <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                    </fn>
                </author-notes>
                <pub-date pub-type="epub">
                    <day>28</day>
                    <month>12</month>
                    <year>2021</year>
                </pub-date>
            </front-stub>
            <body>
                <p>
                    <italic>While I agree that Wolbachia infection may be influenced by temperature, the study failed to demonstrate that temperature was the reason why Wolbachia prevalence was reduced and fragmented in each city. Given the warm season is also associated with high vector abundance, how are the authors certain that there was no effect of immigration of mosquitoes from neighboring areas, not receiving the intervention? Could it be that both immigration and temperature operated in this specific context?</italic>
                </p>
                <p>
                    <italic> </italic>
                </p>
                <p>
                    <italic> Tri Nguyen village is on an island separated from the mainland and Wolbachia mosquito releases were undertaken throughout essentially all of the populated areas on the island. The number of immigrant mosquitoes on the island would be relatively small in relation to the native Ae. aegypti population. Similarly in Vinh Luong, while located on the mainland, it is essentially surrounded by uninhabited areas with limited habitat for Ae. aegypti, so immigration would be limited. We don't consider immigration of uninfected mosquitoes into the release areas to have played a major role in the observed fluctuations in Wolbachia.</italic>
                </p>
                <p> </p>
                <p> In response to this reviewer's comment on seasonal variation in vector abundance and the effect on 
                    <italic>Wolbachia</italic> establishment, and also in response to Reviewer 1 comments on 
                    <italic>Ae. aegypti</italic> population abundance, we have now added Figure 13 and also undertaken additional statistical analyses. The following text was added to the Results and Discussion:</p>
                <p> </p>
                <p> "There was no clear association between 
                    <italic>Wolbachia</italic> establishment in local mosquito populations and seasonal or spatial differences in 
                    <italic>Ae. aegypti</italic> abundance in BGS traps. 
                    <italic>Ae. aegypti</italic> adult mosquito numbers in BGS traps were significantly (P&lt;0.05) higher during the hot season (May to October) compared with the cool season (November to April) across all sites (Tri Nguyen North 
                    <italic>Ae. aegypti </italic>mean catch ratio 1.28 [95% CI 1.18, 1.39]; Center 1.17 [1.07, 1.28]; South 1.42 [1.30, 1.54], Vinh Luong 1.22 [1.22, 1.32]) (Figure 13). In terms of overall mean 
                    <italic>Ae. aegypti</italic> numbers in BGS traps during non-release periods, mosquito densities were significantly higher in Tri Nguyen in the South (Mean catch ratio 1.94 [95%CI 1.26, 2.98]) and Center zones (1.69 [1.16, 2.47]) compared with Vinh Luong; however the numbers in Tri Nguyen North were not significantly different to Vinh Luong (1.18 [0.84, 1.68]). Despite the similar and relatively low mosquito densities in Tri Nguyen in the North and in Vinh Luong, and similar seasonal variations in mosquito densities, 
                    <italic>Wolbachia</italic> persistence was high across Vinh Luong; whereas its persistence was low in the Tri Nguyen North zone. In contrast, the Tri Nguyen South zone had almost twice the mean numbers of 
                    <italic>Ae. aegypti</italic> in BGS traps, compared with Vinh Luong, and 
                    <italic>Wolbachia</italic> persistence was high across both sites. Comparisons of 
                    <italic>Ae. aegypti</italic> numbers in BGS traps before and after releases indicated that 
                    <italic>Ae. aegypti</italic> numbers in Tri Nguyen were higher in the post-release period compared with the pre-release period (Mean catch ratio 1.29 [95% CI 1.18, 1.41]), whereas in Vinh Luong the reverse was observed, with a reduction in numbers during the post-release period (Mean catch ratio 0.87 [95% CI 0.80, 0.96]). Within zone differences in 
                    <italic>Ae. aegypti</italic> numbers before and after releases were found in Tri Nguyen, with significantly higher numbers during the post release periods in the Center and South areas (
                    <italic>Ae. aegypti</italic> mean catch ratios 1.60 [95% CI 1.37, 1.88] and 1.33 [1.15, 1.55], respectively), but not in the North zone (1.04 [0.89, 1.22]). Although these analyses were adjusted for season, they may still be confounded by seasonality as the pre-release monitoring period in both locations was very short (4-5 months). Not surprisingly, the mean numbers of 
                    <italic>Ae. aegypti</italic> in BGS traps during the releases were higher than the numbers during non-release periods in both Tri Nguyen (Mean catch ratio 1.82 [95% CI 1.69, 1.96]) and Vinh Luong (1.98 [1.82, 2.15])."</p>
                <p> </p>
                <p> </p>
                <p> 
                    <italic>While temperature effects on WMel are documented from the lab, this study did not conduct any experimental quantification of the role of temperature on WMel infection in the field. Again, it is speculative to assume temperature was the only cause.</italic>
                </p>
                <p> </p>
                <p> We acknowledge that there was no experimental data to link field temperatures to reduced Wolbachia prevalence. We have added the text below to the Results and Discussion.</p>
                <p> </p>
                <p> "Although we did not measure the temperatures in water containers in the field, our study of maternal transmission in field containers set during the two consecutive hot seasons confirm the loss of 
                    <italic>w</italic>Mel infection in the progeny of 
                    <italic>Wolbachia</italic> infected female mosquitoes. This seasonal loss of 
                    <italic>w</italic>Mel infection in 
                    <italic>Ae. aegypti</italic> mosquitoes may be due to high temperatures in these larval habitats. Several studies have demonstrated that temperatures &gt;35&#x00b0;C significantly reduce 
                    <italic>Wolbachia</italic> infections in 
                    <italic>Ae. aegypti</italic> larvae, especially younger instars (Ross et al. 2017, 2019, 2020; Ulrich et al. 2016). Detailed entomological surveys on Tri Nguyen found that large water storage tanks and jars were responsible for over 90% of larval and pupal production (Jeffrey et al. 2009). While temperatures in nearby Nha Trang indicate air temperatures in summer only occasionally exceed 35&#x00b0;C, it is likely that tanks and jars exposed to sunshine would be subject to solar gain and water within them could heat up. Heating of water in containers exposed to even partial sunshine can result in spikes in temperature &gt; 35&#x00b0;C, and concurrent significant loss in 
                    <italic>w</italic>Mel density (Ross et al. 2019). Indeed, the amount of water inside tanks and jars may be at a minimum just when temperatures peak in the late dry season. Water in these tanks may heat well beyond 35&#x00b0;C and cure 
                    <italic>w</italic>Mel infections. Thus, it is critical that seasonal temperatures and 
                    <italic>w</italic>Mel levels in 
                    <italic>Ae. aegypti</italic> be monitored in a range of containers in shade and sunlight during the dry season."</p>
                <p> </p>
                <p> 
                    <italic>While there is evidence of WMel infection presence, how about WMel density? Why are not loads of WMel in mosquitoes reported as in other WMP studies?</italic>
                </p>
                <p> </p>
                <p> We have added Figure 12 showing 
                    <italic>Wolbachia</italic> density in 
                    <italic>Ae. aegypti</italic> mosquitoes collected in BGS traps from Tri Nguyen and Vinh Luong, and Table 5 showing the correlation between 
                    <italic>w</italic>Mel density in weekly collections of 
                    <italic>Ae. aegypti</italic> and the current and lagged mean daily temperature measured in households in Tri Nguyen and Vinh Luong.</p>
                <p> </p>
                <p> The following text was added to the Methods section:</p>
                <p> </p>
                <p> "The density of 
                    <italic>Wolbachia </italic>in 
                    <italic>Ae. aegypti </italic>caught over time was summarized as the median relative density value in 
                    <italic>Ae. aegypti </italic>caught each week during the post-release period, in each of the three Tri Nguyen areas (north, central, south) and in Vinh Luong. A distributed lag linear regression model was used to fit weekly median 
                    <italic>Wolbachia </italic>density to the mean daily temperature measured inside houses. The model included values of weekly mean daily temperature lagged up to 5 weeks for the three Tri Nguyen areas and 4 weeks for Vinh Luong, with maximum lag determined using the Akaike Information Criterion (AIC). Newey-West standard errors were calculated to account for autocorrelation in weekly median 
                    <italic>Wolbachia </italic>density, with maximum lag 9 for the three Tri Nguyen areas and maximum lag 5 for Vinh Luong."</p>
                <p> </p>
                <p> We have also inserted the following text in the Results and Discussion:</p>
                <p> </p>
                <p> "
                    <italic>Wolbachia</italic> density in 
                    <italic>Ae. aegypti</italic> mosquitoes collected in BGS traps varied seasonally across both Tri Nguyen and Vinh Luong (Figure 12). There was a significant negative correlation between the weekly median 
                    <italic>Wolbachia</italic> density in mosquitoes trapped during the post-release period and the weekly mean daily temperatures measured in households, in each region of Tri Nguyen and in Vinh Luong (Table 5). This association was significant for both male and female 
                    <italic>Wolbachia</italic>-infected mosquitoes, but was much more pronounced in females. Associations were strongest when lagged temperature values of up to 5 weeks were included in the model for Tri Nguyen and up to 4 weeks for Vinh Luong."</p>
                <p> </p>
                <p> </p>
                <p> </p>
                <p> Minor comments:</p>
                <p> 
                    <italic>The figures show mean numbers of mosquitoes but exclude the variability around the mean. Report standard errors or other measure.</italic>
                </p>
                <p> </p>
                <p> Figures 6 and 7 show 
                    <italic>Wolbachia</italic> infection prevalence in mosquitoes, not the mean numbers of mosquitoes (total positives / total number tested - blue line, median 
                    <italic>Wolbachia</italic> prevalence in mosquitoes per BG trap collection - red line, interquartile range - box plots). In response to Reviewer 1 comment, we have added Figure 13 that shows the Mean (+/- standard deviation [SD]) numbers of 
                    <italic>Aedes aegypti</italic> mosquitoes collected in BGS traps per week.</p>
                <p> </p>
                <p> </p>
                <p> </p>
                <p> The authors made an additional, minor correction to the ms. In the 
                    <italic>Wolbachia</italic> screening section in the Methods, the following were corrected:</p>
                <p> </p>
                <p> " either TM513 (primers F: 5&#x2019;-CAAATTGCTCTTGTCCTGTGG -3&#x2019;, R: 5&#x2019;-GGGTGTTAAGCAGAGTTACGG-3&#x2019; and probe 5&#x2019;-LC640 -TGAAATGGAAAAATTGGCGAGGTGTAGG-iowaBlack-3&#x2019;) or"</p>
                <p> </p>
                <p> "TM513 primers and probe were used for Tri Nguyen samples to keep consistency with primary results and WSP primers and probe was used for Vinh Luong ward to reduce the possible effect of gene copy number variation in comparison with WS0513 gene."</p>
                <p> </p>
                <p> The underlying data for Figures 12 and 13 have been uploaded to Figshare:</p>
                <p> </p>
                <p> Ryan, Peter (2021): Wolbachia density data. figshare. Dataset. https://doi.org/10.6084/m9.figshare.17427479.v1</p>
                <p> </p>
                <p> Ryan, Peter (2021): TN BGS Ae. aegypti Abundance. figshare. Dataset. https://doi.org/10.6084/m9.figshare.17427434.v1&#x00a0;</p>
                <p> </p>
                <p> Ryan, Peter (2021): VL BGS Ae. aegypti Abundance. figshare. Dataset. https://doi.org/10.6084/m9.figshare.17427470.v1</p>
            </body>
        </sub-article>
    </sub-article>
    <sub-article article-type="reviewer-report" id="report31210">
        <front-stub>
            <article-id pub-id-type="doi">10.21956/gatesopenres.14590.r31210</article-id>
            <title-group>
                <article-title>Reviewer response for version 1</article-title>
            </title-group>
            <contrib-group>
                <contrib contrib-type="author">
                    <name>
                        <surname>Xi</surname>
                        <given-names>Zhiyong</given-names>
                    </name>
                    <xref ref-type="aff" rid="r31210a1">1</xref>
                    <role>Referee</role>
                    <uri content-type="orcid">https://orcid.org/0000-0001-7786-012X</uri>
                </contrib>
                <aff id="r31210a1">
                    <label>1</label>Department of Microbiology and Molecular Genetics, Michigan State University, East Lansing, Minnesota, USA</aff>
            </contrib-group>
            <author-notes>
                <fn fn-type="conflict">
                    <p>
                        <bold>Competing interests: </bold>I am affiliated with the Guangzhou Wolbaki Biotech Co.,Ltd. I confirm that this potential conflict of interest did not affect my ability to write an objective and unbiased review of the article.</p>
                </fn>
            </author-notes>
            <pub-date pub-type="epub">
                <day>15</day>
                <month>10</month>
                <year>2021</year>
            </pub-date>
            <permissions>
                <copyright-statement>Copyright: &#x00a9; 2021 Xi Z</copyright-statement>
                <copyright-year>2021</copyright-year>
                <license xlink:href="https://creativecommons.org/licenses/by/4.0/">
                    <license-p>This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</license-p>
                </license>
            </permissions>
            <related-article ext-link-type="doi" id="relatedArticleReport31210" related-article-type="peer-reviewed-article" xlink:href="10.12688/gatesopenres.13347.1"/>
            <custom-meta-group>
                <custom-meta>
                    <meta-name>recommendation</meta-name>
                    <meta-value>approve</meta-value>
                </custom-meta>
            </custom-meta-group>
        </front-stub>
        <body>
            <p>Hien 
                <italic>et al.</italic> report different dynamics of 
                <italic>Wolbachia </italic>strain wMel after being released into two field sites in Vietnam, with loss of wMel in two areas of one site and maintenance of high infection in another site. In both sites, a decrease of Wolbachia infection frequency was associated with elevated temperature conditions. However, this high temperature alone can not explain the loss of infection, indicating presence of other factors influencing the local establishment of Wolbachia infection. These discoveries can significantly advance our knowledge of Wolbachia dynamic in field settings and across seasons, support the notion that various Wolbachia strain may be required for different locations when Wolbachia is deployed globally for mosquito-borne disease control. Below are some minor points:</p>
            <p> &#x00a0;&#x00a0;</p>
            <p> Data show that more mosquitoes were released in Tri Nguyen (32.4 mosquito/house) than in Vinh Luong (11.5 mosquitoes/house) and it took longer time in Tri Nguyen (27 weeks) than in Vinh Luong (17 weeks) to reach a similar infection frequency (~80%). This may indicate that the mosquito population in Tri Nguyen is more difficult for Wolbachia to invade and spread than Vinh Luong. In addition to abiotic factors, difference in mosquito density, population structure and distribution in two release sites may also contribute to the above observation. It will be helpful if the authors can provide some baseline mosquito data before release in these two sites. For example, is it possible that the original mosquito density in Tri Nguyen is much higher than in Vinh Luong such that more release is required in the former? Or whether there is any difference in mosquito populations between North/Central and South Tri Nguyen?</p>
            <p> </p>
            <p> The authors are suggested to use the same title, mosquitoes released per house per week, for the first Y-axis of both Figures 4 and 5 such that they can be easily compared.</p>
            <p> </p>
            <p> Figure 6, as no data between June 2019 and April 2021, it is better to put a break in the X-axis to avoid misleading. Same for Figure 7 between Dec 2019 and Nov 2020.</p>
            <p> </p>
            <p> Figure 6 and 7, it is likely that both temperature and dry condition contribute to loss of Wolbachia infection. The authors are suggested to provide rainfall or humidity data in parallel with temperature in the figure.</p>
            <p> </p>
            <p> Figure 8 shows that, different from other years, there was a large number of BG traps without
                <italic> Aedes aegypti</italic> detected in Dec 2016 and July 2017 which occurred mainly in north and center areas and coincides with a large drop of infection frequency below the threshold in these two locations. From Figure 8 and 9, there appears to be a much lower mosquito density in 2019 and 2021 as compared to 2014 and 2015. The authors are suggested to confirm and/or discuss about these observations. &#x00a0;</p>
            <p> </p>
            <p> There is redundant description in a number of places. Below are two examples. &#x00a0; 
                <list list-type="order">
                    <list-item>
                        <p>One in the introduction and another in the discussion (repeat twice): a 69% reduction in dengue incidence, a 56% reduction in chikungunya incidence and a 37% reduction in Zika incidence.</p>
                    </list-item>
                    <list-item>
                        <p>One in page 6 and another in page 10 (repeat twice): After 24 h a human blood meal was provided and individual females that appeared fully engorged were placed into individual oviposition cups. &#x2026; After 24 hours the number of hatched larvae were recorded. Larvae were reared until they reached II-IV instar then transferred to 70% ethanol.</p>
                    </list-item>
                </list>
            </p>
            <p>Is the work clearly and accurately presented and does it cite the current literature?</p>
            <p>Yes</p>
            <p>If applicable, is the statistical analysis and its interpretation appropriate?</p>
            <p>Not applicable</p>
            <p>Are all the source data underlying the results available to ensure full reproducibility?</p>
            <p>Yes</p>
            <p>Is the study design appropriate and is the work technically sound?</p>
            <p>Yes</p>
            <p>Are the conclusions drawn adequately supported by the results?</p>
            <p>Yes</p>
            <p>Are sufficient details of methods and analysis provided to allow replication by others?</p>
            <p>Yes</p>
            <p>Reviewer Expertise:</p>
            <p>Wolbachia, mosquito, medical entomology, dengue</p>
            <p>I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.</p>
        </body>
        <sub-article article-type="response" id="comment3491-31210">
            <front-stub>
                <contrib-group>
                    <contrib contrib-type="author">
                        <name>
                            <surname>Ryan</surname>
                            <given-names>Peter</given-names>
                        </name>
                        <aff>World Mosquito Program, Vietnam</aff>
                    </contrib>
                </contrib-group>
                <author-notes>
                    <fn fn-type="conflict">
                        <p>
                            <bold>Competing interests: </bold>No competing interests were disclosed.</p>
                    </fn>
                </author-notes>
                <pub-date pub-type="epub">
                    <day>28</day>
                    <month>12</month>
                    <year>2021</year>
                </pub-date>
            </front-stub>
            <body>
                <p>
                    <italic>Data show that more mosquitoes were released in Tri Nguyen (32.4 mosquito/house) than in Vinh Luong (11.5 mosquitoes/house) and it took longer time in Tri Nguyen (27 weeks) than in Vinh Luong (17 weeks) to reach a similar infection frequency (~80%). This may indicate that the mosquito population in Tri Nguyen is more difficult for Wolbachia to invade and spread than Vinh Luong. In addition to abiotic factors, difference in mosquito density, population structure and distribution in two release sites may also contribute to the above observation. It will be helpful if the authors can provide some baseline mosquito data before release in these two sites. For example, is it possible that the original mosquito density in Tri Nguyen is much higher than in Vinh Luong such that more release is required in the former? Or whether there is any difference in mosquito populations between North/Central and South Tri Nguyen?</italic>
                </p>
                <p> </p>
                <p> 
                    <italic>The authors are suggested to use the same title, mosquitoes released per house per week, for the first Y-axis of both Figures 4 and 5 such that they can be easily compared.</italic>
                </p>
                <p> </p>
                <p> This has been corrected. Figure 5 has been revised with the Y-axis now showing "Mean numbers of 
                    <italic>Wolbachia</italic> mosquitoes released per house per week", which is consistent with Figure 4.</p>
                <p> </p>
                <p> 
                    <italic>Figure 6, as no data between June 2019 and April 2021, it is better to put a break in the X-axis to avoid misleading. Same for Figure 7 between Dec 2019 and Nov 2020.</italic>
                </p>
                <p> </p>
                <p> These have been corrected. Figures 6 and 7 have been revised and now include breaks in the 
                    <italic>Wolbachia </italic>frequency curves (Mean and Median) to indicate there was no monitoring data during these periods. The X-Axes have been retained as there were, as the graphs contain temperature and rainfall data throughout the entire study period. Text has also been added to the figure captions to indicate that there was no 
                    <italic>Wolbachia</italic> monitoring data during the respective periods for Tri Nguyen (Figure 6) and Vinh Luong (Figure 7).</p>
                <p> </p>
                <p> 
                    <italic>Figure 6 and 7, it is likely that both temperature and dry condition contribute to loss of Wolbachia infection. The authors are suggested to provide rainfall or humidity data in parallel with temperature in the figure.</italic>
                </p>
                <p> </p>
                <p> Figures 6 and 7 have been revised and now include weekly rainfall data.</p>
                <p> </p>
                <p> 
                    <italic>Figure 8 shows that, different from other years, there was a large number of BG traps without Aedes aegypti detected in Dec 2016 and July 2017 which occurred mainly in north and center areas and coincides with a large drop of infection frequency below the threshold in these two locations. From Figure 8 and 9, there appears to be a much lower mosquito density in 2019 and 2021 as compared to 2014 and 2015. The authors are suggested to confirm and/or discuss about these observations.</italic>
                </p>
                <p> </p>
                <p> With thank the reviewer for this comment. We have inserted an additional figure (Figure 13) that shows the Mean +/- standard deviation numbers of 
                    <italic>Ae. aegypti</italic> per BGS trap per week (Note: 
                    <italic>Wolbachia</italic> infection screening was not undertaken on all sampling weeks, so there is additional weekly mosquito density data in Figure 13, compared to the weeks with 
                    <italic>Wolbachia</italic> screening data in Figures 6-10.</p>
                <p> </p>
                <p> Additional statistical analyses were undertaken to determine whether there were differences in the mean 
                    <italic>Ae. aegypti</italic> numbers in BGS traps between pre-release and post-release periods in Tri Nguyen and Vinh Luong. The following has been added to the methods section:</p>
                <p> </p>
                <p> "Statistical analysis</p>
                <p> </p>
                <p> The number of 
                    <italic>Ae. aegypti</italic> mosquitoes caught over time was summarized as the mean count per BGS trap per week, in each of the three Tri Nguyen areas (north, central, south) and in Vinh Luong. Mixed-effects negative binomial regression was used to compare the number of 
                    <italic>Ae. aegypti</italic> caught per BGS trap per week, between pre- and post-release periods, with the inclusion of BGS trap as a random effect to account for clustering at the trap level. All analyses included a binary indicator for hot/cool season as a covariate (hot season = May - October; cool season November - April). The count ratio produced by the negative binomial regression model is the ratio of the mean number of 
                    <italic>Ae. aegypti</italic> caught per trap per week between areas or between release vs non-release periods. Data was analyzed by release status: pre-release, during release, and post-release, and between sites for the total observation period. Analysis of the total observation period was done with the inclusion of an indicator for release status as a covariate."</p>
                <p> </p>
                <p> The following was added to the discussion section (along with additional analyses in response to reviewer 2 comments):</p>
                <p> </p>
                <p> </p>
                <p> "There was no clear association between 
                    <italic>Wolbachia</italic> establishment in local mosquito populations and seasonal or spatial differences in 
                    <italic>Ae. aegypti</italic> abundance in BGS traps. 
                    <italic>Ae. aegypti</italic> adult mosquito numbers in BGS traps were significantly (P&lt;0.05) higher during the hot season (May to October) compared with the cool season (November to April) across all sites (Tri Nguyen North 
                    <italic>Ae. aegypti </italic>mean catch ratio 1.28 [95% CI 1.18, 1.39]; Center 1.17 [1.07, 1.28]; South 1.42 [1.30, 1.54], Vinh Luong 1.22 [1.22, 1.32]) (Figure 13). In terms of overall mean 
                    <italic>Ae. aegypti</italic> numbers in BGS traps during non-release periods, mosquito densities were significantly higher in Tri Nguyen in the South (Mean catch ratio 1.94 [95%CI 1.26, 2.98]) and Center zones (1.69 [1.16, 2.47]) compared with Vinh Luong; however the numbers in Tri Nguyen North were not significantly different to Vinh Luong (1.18 [0.84, 1.68]). Despite the similar and relatively low mosquito densities in Tri Nguyen in the North and in Vinh Luong, and similar seasonal variations in mosquito densities, 
                    <italic>Wolbachia</italic> persistence was high across Vinh Luong; whereas its persistence was low in the Tri Nguyen North zone. In contrast, the Tri Nguyen South zone had almost twice the mean numbers of 
                    <italic>Ae. aegypti</italic> in BGS traps, compared with Vinh Luong, and 
                    <italic>Wolbachia</italic> persistence was high across both sites. Comparisons of 
                    <italic>Ae. aegypti</italic> numbers in BGS traps before and after releases indicated that 
                    <italic>Ae. aegypti</italic> numbers in Tri Nguyen were higher in the post-release period compared with the pre-release period (Mean catch ratio 1.29 [95% CI 1.18, 1.41]), whereas in Vinh Luong the reverse was observed, with a reduction in numbers during the post-release period (Mean catch ratio 0.87 [95% CI 0.80, 0.96]). Within zone differences in 
                    <italic>Ae. aegypti</italic> numbers before and after releases were found in Tri Nguyen, with significantly higher numbers during the post release periods in the Center and South areas (
                    <italic>Ae. aegypti</italic> mean catch ratios 1.60 [95% CI 1.37, 1.88] and 1.33 [1.15, 1.55], respectively), but not in the North zone (1.04 [0.89, 1.22]). Although these analyses were adjusted for season, they may still be confounded by seasonality as the pre-release monitoring period in both locations was very short (4-5 months). Not surprisingly, the mean numbers of 
                    <italic>Ae. aegypti</italic> in BGS traps during the releases were higher than the numbers during non-release periods in both Tri Nguyen (Mean catch ratio 1.82 [95% CI 1.69, 1.96]) and Vinh Luong (1.98 [1.82, 2.15])."</p>
                <p> </p>
                <p> </p>
                <p> </p>
                <p> 
                    <italic>There is redundant description in a number of places. Below are two examples.&#x00a0;</italic>
                </p>
                <p>
                    <italic> One in the introduction and another in the discussion (repeat twice): a 69% reduction in dengue incidence, a 56% reduction in chikungunya incidence and a 37% reduction in Zika incidence.</italic>
                </p>
                <p> </p>
                <p> This has been corrected. The following has been deleted from the discussion "Aggregate across the whole intervention area, the 
                    <italic>w</italic>Mel deployments were associated with a 69% reduction in dengue incidence, a 56% reduction in chikungunya incidence and a 37% reduction in Zika incidence."</p>
                <p> 
                    <italic>One in page 6 and another in page 10 (repeat twice): After 24 h a human blood meal was provided and individual females that appeared fully engorged were placed into individual oviposition cups. &#x2026; After 24 hours the number of hatched larvae were recorded. Larvae were reared until they reached II-IV instar then transferred to 70% ethanol.</italic>
                </p>
                <p> </p>
                <p> </p>
                <p> This has been corrected. The following has been deleted from the methods section "After 24 h a human blood meal was provided and individual females that appeared fully engorged were removed from the cage and placed into individual oviposition cups. Each cup was lined with a piece of filter paper as a medium for oviposition. After 24 hrs following oviposition, the female mosquitoes were collected and stored in 70% ethanol, and the eggs were counted and then conditioned for three days, prior to hatching in water containing a small amount of fish food (JBL NovoTab, Neuhofen, Germany, Product number 302300). After 24 hours the number of hatched larvae were recorded. Larvae were reared until they reached II-IV instar then transferred to 70% ethanol. Adult females and progeny (n=10-20) were processed for Wolbachia infection using a Taqman qPCR assay (Dar et al., 2008; O&#x2019;Neill et al., 2019; Yeap et al., 2014)."</p>
                <p> </p>
                <p> The above text was replaced with the following "Mosquitoes were blood fed and the progeny were processed as described previously, except immatures were fed on JBL NovoTab fish food (JBL NovoTab, Neuhofen, Germany, Product number 302300)."</p>
            </body>
        </sub-article>
    </sub-article>
</article>
